Перевести страницу

Пикотехнология вкратце

Подписаться на RSS

Популярные теги Все теги

Пикотехнология помогает визуально обнаружить активные центры белка


Рассмотрим более внимательно структуру конкурсного белка T0691:



Обратите внимание на расположение радикалов триптофана (квадратный 3х3) и тирозина (бензольное кольцо с группой OH) на переднем плане.



На заднем плане за радикалом триптофана тоже виден какой-то радикал. Всё это напоминает типовую структуру активного центра с резонансной системой.



Материал с форума лаборатории Наномир: 


diprospan: да, и подтверждается тем, что совпадает дипольный момент:




Кушелев: Вы не могли бы дать более развёрнутый комментарий? Что за момент, с чем совпадает, откуда это видно? 



В белке T0692 тоже обнаружился любопытный фрагмент, характерный для активных центров белка... 



 Наличие цикличного участка белка T0694, вероятно, можно проверить экспериментально. 


Кушелев: И что с чем совпадает? 

diprospan: активный центр белка пожалуй лучшее ваше определение в этом векторе.

Кушелев: Вы хотите сказать, что активный центр попадает в зону максимальной напряжённости электрического поля? Такое совпадение действительно вряд ли случайно...


Поле ориентирует некую полярную молекулу, после чего её обрабатывают на триптофановой наковальне в резонансном (?) режиме



Вторичная структура фактически замыкается. Изображение получено в браузере Avogadro




Любопытная структура белка T0697. Возможно, что спираль гнется на пролинах и образует некий реберный многогранник... 



T0692, Trp467

Кушелев: Согласитесь, что таких совпадений не бывает... 



Источник





Тайны цитоскелета

Сотовая четвертичная структура белка OLQ02947

раскрывает тайны цитоскелета 

 Symbiodinium microadriaticum.




Вот, что известно о белке, в состав которого входит эта гиперспираль: https://www.uniprot.org/uniprot/Q54KA7


Цитата: Protein: Ankyrin repeat Molecular function: guanyl-nucleotide exchange factor activity

Цитата2: actin cytoskeleton organization 

Кушелев: Автоперевод на русский: организация актинового цитоскелета

Ну что же, неплохо для начала. Цитоскелет из трёхгранных призм очень функционален. Теперь слово за структурными биологами, которые знают о структуре этого белка из "мокрых экспериментов". 



В реальном белке три слоя, причём состоящих из более тонких слоёв. Первый слой состоит из 4 более тонких. Далее происходит смещение. Под альфа-спиралями (красный) оказываются пи-спирали (голубой). Этот второй слой в свою очередь состоит из 7 более тонких. Далее происходит второе смещение. Под пи-спиралями второго слоя (голубой) оказываются 310-спирали (оранжевый). Этот третий слой состоит из трёх более тонких. В итоге каждая грань каждой треугольной призмы состоит из спиралей трёх типов. Это значит, что параметры граней являются усреднёнными параметрами трёх типов спиралей. Это обусловливает высокую стабильность геометрии. Чем-то напоминает свойство пчелиных сот. Видимо, это очень важно для цитоскелета (скелета клетки) Symbiodinium microadriaticum.

Уточнение 2D структур некоторых белков, взятых из базы NCBI, методом Пикотех

*

*Посмотреть примеры пяти полных 2D Диаграмм Пикотех


https://img-fotki.yandex.ru/get/880375/249950893.0/0_16a3b7_7315a46a_orig.png

https://img-fotki.yandex.ru/get/893753/249950893.1/0_16aff1_b0049741_orig.png

Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.





https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcd_1b4a76df_orig.png

https://img-fotki.yandex.ru/get/509739/249950893.1/0_16b0a0_f8fd49ff_orig.png


147-173 - наиболее протяженный участок альфа-310-спирали. 
Весь белок представлен преимущественно участками альфа-310-спиралей.

Две программных спирали в одной белковой цепи

*


Примеры программных спиралей



В этом фрагменте белка присутствуют две программных спирали.



Программная 1111223553355532114135322332-спираль. Период 28 аминокислотных остатков.

https://img-fotki.yandex.ru/get/5411/158289418.42a/0_17b200_1f6190d0_orig.png

Программная 111135332332-спираль. Период 12 аминокислотных остатков.

https://img-fotki.yandex.ru/get/143523/158289418.42a/0_17b1fb_633f86a8_orig.png


https://img-fotki.yandex.ru/get/198786/158289418.42a/0_17b1f6_680c4b41_XL.png





Пикотехнолгия помогла найти ошибки рентгено-структурного анализа

*

*

Высоко периодичные структуры белков


РСА: что мы видим?


Пикотехнологические программные спирали белка



Модель коллагена (программная 335-спираль) -  яркая демонстрация несовершенства рентгеноструктурного анализа. Специалисты по РСА конструируют спираль коллагена из того, что им известно. А известна им альфа-спираль. Вот они и сконструировали модель из 3 альфа-спиралей. Программа Пикотех показывает, что это не тройная, а одинарная, но программная 335-спираль. Радикалы аминокислот действительно располагаются в виде трёх-заходной спирали, что и сбило с толку специалистов по РСА.

Другие программные спирали специалисты по РСА тоже ошибочно интерпретируют известными им "базовыми спиралями", но настало время показать, как устроены реальные, программные спирали белков.

Другими яркими примерами, демонстрирующими несостоятельность РСА, являются  сверхдлинные, в том числе программные спирали.

Наконец, Пикотехнология в отличие от РСА имеет возможность самоповерки. В частности, самоповеркой является 100%-ная корреляция между первичной и вторичной структурой некоторых белков, например, сверхдлинных программных спиралей. Спирали длиной более 1000 витков исключают случайные совпадения, согласитесь. Например, вероятность случайного совпадения композиционных кодов для 310-спирали длиной более 3982 аминокислотных остатков не превышает 4^-3982=2.5*10^-2397, т.е. более двух тысяч нулей после запятой.    


 


https://img-fotki.yandex.ru/get/4000/158289418.421/0_17aaf5_65d3d6c0_orig.gif

Пикотехнология помогла найти ошибки рентгено-структурного анализа

*

*

Формы, механизмы, энергия наномира. Сообщение 91 643

Что такое программа "Пикотехнология белков", и как её грамотно использовать

Пикотехнология помогла найти ошибки рентгеноструктурного анализа

https://img-fotki.yandex.ru/get/4000/158289418.421/0_17aaf5_65d3d6c0_orig.gif

Формы, механизмы, энергия наномира. Сообщение 88 047

Онлайн сервис белковых структур уже функционирует!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

>ENA|ALI34365|complement 1830 nucleotides
ttgagtcttacagaaaaatgtgatatttatgcagctcttcatgatgcaggaattaataga
gtggttaaacatcttatgcaacagcgcccgtctctttttaattttggtacttccttttta
gcatcaaatccaaatctattgtgtgaaaaaattatagctgtgcaagaagtaaacagacaa
cagaatcctcttttaacaatactagaaccaattcctgtcattggtctaccattaagccaa
tctagttcaaacaatttggcaataaattttgcaattcaactttctaaagctgaaatagat
ttccatgaagggaatgtatttcctttaccttcagaacttgtcccattggcaaatcaacgt
ttggctactcatttcaaagtttgtgccggcttggattgtctcggggacttgcctgttctt
agaaggcctccaaataccagaccgtctacttccaaactagaatgtttttgtctagatttg
tatgctataggtggatgcaaaatctctggattagcagaaaaccaaaaaatagggctcaaa
attgatgggatagagatagtggatttaaaaccccaaggattggaaaatgcaatcgaatgt
tatgcaaaatctgtacttaatcatggaatttttccccatgttgctgagattatttccaaa
ttgacatttgggataattactattcctccatccaatggtaacttccaagtatcaggaaat
ttgcagctttcaggaactacgaccgttcctagtaatcctgcaatcgaagatgatcaatta
aaaacatttatcaatttagacaatttggacttggatatcgtattctcaccaaatggtggc
ggtagtggcggtagtggcggtagtggcggcagtggcggcagtggcggtagtggcggcagt
ggaacaataacaagaacagtgaggccgcgatcaagaacaggcacctttgatctaaccgct
gctatatccgaaactacatttaaaaaaatatatggtgcccttcttgaaggatttaaattt
tcagtatcagacacgggcggctctggtatattctcagtaggttatacagtttcggctcat
ttagagaatggcacaatcgatctgcggaataatggttctattctaataagtgaattagac
gtgaaatgggacacattgcagcttaacataggcatagatattccaacacaaactattggt
ggcttttgcctcgttccaaatccatttggtggatgtttgattcgtgctccgtcaattgat
ctttttgaagcatcacctgatatttctttacccttgaacttgggtggactaataacatct
gaaattactttgagtgtaattccaaaggtgttttatggagttggctctggaattccaaac
agatggcaacttaccttagtccctacgcttccaatcgacttggatataattgacgtagca
gacacaattggagatttatttcataatctgattacaaatgcaattgtcagtcttcttagt
tctttgggactccctgattgggctatatcttttatagataccgtgcttggtggaatagaa
ggaataatccgaaacattctagatattggagacgatgtgggtgaatttattttaagtttg
attagtaatgttggtctattccaggatttgattgataagctggctcaattcatagcgctt
acgattctggaactcaaggatcccttggaagttcttgagggaaattctgccataccttta
attccagtaaagttaccaattgaatttttggatgttcggatcgatggtaatggtaatgag
ttgatccttgaaggggatgtgggtaattag

Результат:

https://img-fotki.yandex.ru/get/6109/158289418.423/0_17abfe_d7a43aa6_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/97884/1 … 0_orig.png

https://img-fotki.yandex.ru/get/196102/158289418.423/0_17abff_1e4e2a21_orig.png
В исследуемом белке обнаружен переход программной 335-спирали, характерной для коллагена первого типа в программную 553-спираль, которые строятся под музыку с размером 3/8 (в темпе вальса, точнее в темпе коллагена). Далее программная спираль переходит в бета-спираль длиной 4 аминокислотных остатка.

Кушелев: Модель коллагена (программная 335-спираль) очень яркая демонстрация несовершенства рентгеноструктурного анализа. Специалисты по РСА конструируют спираль коллагена из того, что им известно. А известна им альфа-спираль. Вот они и сконструировали модель из 3 альфа-спиралей. Программа Пикотех показывает, что это не тройная, а одинарная, но программная 335-спираль. Радикалы аминокислот действительно располагаются в виде трёх-заходной спирали, что и сбило с толку специалистов по РСА.

Другие программные спирали специалисты по РСА тоже ошибочно интерпретируют известными им "базовыми спиралями", но настало время показать, как устроены реальные, программные спирали белков. Некоторые из них имеют очень необычные параметры. Такова, например, программная 35-спираль:

https://img-fotki.yandex.ru/get/198860/158289418.3e0/0_176329_6d9df850_L.gif
Подробнее: http://nanoworld.org.ru/topic/1699/

Другими яркими примерами, демонстрирующими несостоятельность РСА, являются сверхдлинные в т.ч. программные спирали/


Наконец, Пикотехнология в отличие от РСА имеет возможность самоповерки. В частности, самоповеркой является 100%-ная корреляция между первичной и вторичной структурой некоторых белков, например, сверхдлинных программных спиралей. Спирали длиной более 1000 витков исключают случайные совпадения, согласитесь. Например, вероятность случайного совпадения композиционных кодов для 310-спирали длиной более 3982 аминокислотных остатков не превышает 4^-3982=2.5*10^-2397, т.е. более двух тысяч нулей после запятой  Подробнее об этом белке можно прочесть здесь: http://nanoworld.org.ru/topic/1656/page/5/




    Victoriy пишет:

    где РСА о том, что на участке из 17 а.о. в АПФ (белок от diprospan) действительно 3/10 спираль

    Кушелев: А тут дело уже не в РСА, а в ничтожной вероятности повторения одинаковых кодов "4", "1", "3" и "2".

    Если бы коды "1" и "4" были бы равнозначными, то почему встречаются длинные последовательности 1111111111 и 444444444444 ? По-Вашей гипотезе это бессмысленно.

    По моей это прямые альфа- и 310-спирали соответственно.



      Формы, механизмы, энергия наномира. Сообщение 83 395

      https://img-fotki.yandex.ru/get/195771/158289418.3a9/0_16e45e_5079e0c_orig.png

      Кушелев: Вероятность случайного расположения 17 одинаковых кодов = 0.25^-17 = 5.8*10^-11






      Вероятность случайного расположения 22 звеньев цикла = 0.25^-22 = 5.7*10^-14








      https://img-fotki.yandex.ru/get/176331/158289418.3a9/0_16e469_468e8c12_orig.png

      Вероятность случайного расположения 22 одинаковых кодов = 0.25^-22 = 5.7*10^-14





      http://www.rcsb.org/pdb/explore/explore … ureId=4BT9

      http://www.uniprot.org/uniprot/P13674

      http://www.ebi.ac.uk/ena/data/view/AAA36534

      http://www.ebi.ac.uk/ena/data/view/AAA3 … play=fasta


      >ENA|AAA36534|AAA36534.1 Homo sapiens (human) hypothetical protein 
      ATGATCTGGTATATATTAATTATAGGAATTCTGCTTCCCCAGTCTTTGGCTCATCCAGGC
      TTTTTTACTTCAATTGGTCAGATGACTGATTTGATCCATACTGAGAAAGATCTGGTGACT
      TCTCTGAAAGATTATATTAAGGCAGAAGAGGACAAGTTAGAACAAATAAAAAAATGGGCA
      GAGAAGTTAGATCGGCTAACTAGTACAGCGACAAAAGATCCAGAAGGATTTGTTGGGCAT
      CCAGTAAATGCATTCAAATTAATGAAACGTCTGAATACTGAGTGGAGTGAGTTGGAGAAT
      CTGGTCCTTAAGGATATGTCAGATGGCTTTATCTCTAACCTAACCATTCAGAGACCAGTA
      CTTTCTAATGATGAAGATCAGGTTGGGGCAGCCAAAGCTCTGTTACGTCTCCAGGATACC
      TACAATTTGGATACAGATACCATCTCAAAGGGTAATCTTCCAGGAGTGAAACACAAATCT
      TTTCTAACGGCTGAGGACTGCTTTGAGTTGGGCAAAGTGGCCTATACAGAAGCAGATTAT
      TACCATACGGAACTGTGGATGGAACAAGCCCTAAGGCAACTGGATGAAGGCGAGATTTCT
      ACCATAGATAAAGTCTCTGTTCTAGATTATTTGAGCTATGCGGTATATCAGCAGGGAGAC
      CTGGATAAGGCACTTTTGCTCACAAAGAAGCTTCTTGAACTAGATCCTGAACATCAGAGA
      GCTAATGGTAACTTAAAATATTTTGAGTATATAATGGCTAAAGAAAAAGATGTCAATAAG
      TCTGCTTCAGATGACCAATCTGATCAGAAAACTACACCAAAGAAAAAAGGGGTTGCTGTG
      GATTACCTGCCAGAGAGACAGAAGTACGAAATGCTGTGCCGTGGGGAGGGTATCAAAATG
      ACCCCTCGGAGACAGAAAAAACTCTTTTGCCGCTACCATGATGGAAACCGTAATCCTAAA
      TTTATTCTGGCTCCAGCTAAACAGGAGGATGAATGGGACAAGCCTCGTATTATTCGCTTC
      CATGATATTATTTCTGATGCAGAAATTGAAATCGTCAAAGACCTAGCAAAACCAAGGCTG
      AGCCGAGCTACAGTACATGACCCTGAGACTGGAAAATTGACCACAGCACAGTACAGAGTA
      TCTAAGAGTGCCTGGCTCTCTGGCTATGAAAATCCTGTGGTGTCTCGAATTAATATGAGA
      ATACAAGATCTAACAGGACTAGATGTTTCCACAGCAGAGGAATTACAGGTAGCAAATTAT
      GGAGTTGGAGGACAGTATGAACCCCATTTTGACTTTGCACGGAAAGATGAGCCAGATGCT
      TTCAAAGAGCTGGGGACAGGAAATAGAATTGCTACATGGCTGTTTTATATGAGTGATGTG
      TCTGCAGGAGGAGCCACTGTTTTTCCTGAAGTTGGAGCTAGTGTTTGGCCCAAAAAAGGA
      ACTGCTGTTTTCTGGTATAATCTGTTTGCCAGTGGAGAAGGAGATTATAGTACACGGCAT
      GCAGCCTGTCCAGTGCTAGTTGGCAACAAATGGGTATCCAATAAATGGCTCCATGAACGT
      GGACAAGAATTTCGAAGACCTTGTACGTTGTCAGAATTGGAATGA


      https://img-fotki.yandex.ru/get/100269/158289418.3a9/0_16e46a_42bf249f_orig.png


      Много обещающая альфа-спираль с 21 по 71!!!

      А что нам покажет программа Пикотех?

      https://img-fotki.yandex.ru/get/194503/ … 6_orig.gif

      Такова однако точность РСА...

      https://img-fotki.yandex.ru/get/3505/158289418.3a9/0_16e46d_b82fdb29_orig.png
      Эта периодическая структура может оказаться ...  научным прорывом. Но это мы проверим уже завтра...





        Формы, механизмы, энергия наномира. Сообщение 83 417

        Victoriy пишет:

        Похоже я открыла ящик Пандоры, научив А.Ю. пользоваться PDB . 
        Уважаемый Александр Юрьевич, давайте вместе проанализируем Ваш материал по кодированию различных видов спиралей на основе экспериментально показанных спиральных участков в белках 1TAG; 3SDH; 1GPB; 1PZ4; 1OBO; 1GS6; 1H1N; 1LRV и АПФ от Дипроспана. Структура последнего энзима мне лично не безразлично, т.к. его активность в сыворотке крови пациентов с лакунарными инсультами я определяла в этом году в одной из текущих НИР.
        Предлагаю в скайпе голосом, а потом Вы выложите свой материал на форуме.

        На форум интересно текст выложить, а не голос  Давайте сначала разберёмся с самоповеркой пикотехнологии

        Согласитесь, что таких случайностей просто не бывает 

        Кстати, эта тема имеет продолжение

        Итак, вопрос для богини пикотехнологии, Виктории Соколик:

        "Вы согласны, что структуры альфа-спирали, 310-спирали, фрагмента лизоцима из этой темы однозначно подтверждают:

        1. Кодирование прямой альфа-спирали кодами -1111111111111111111111-
        2. Кодирование прямой 310-спирали кодами -444444444444-
        3. Программирование цикла из 22 аминокислотных остатков лизоцима" ?

        Если есть возражения, то жду Ваших аргументов. Пока мы не придём к консенсусу по данному вопросу, более сложные вопросы, как то нюансы статистики, я обсуждать не готов.




          Формы, механизмы, энергия наномира. Сообщение 83 415

          http://www.rcsb.org/pdb/explore/explore … ureId=5KYN

          https://img-fotki.yandex.ru/get/169608/158289418.3aa/0_16e49f_d788664d_XL.png

          http://www.uniprot.org/uniprot/Q15436

          http://www.ebi.ac.uk/ena/data/view/CAA65774

          https://img-fotki.yandex.ru/get/50623/1 … 8_orig.gif

          Как видим, данные РСА опять не соответствуют даже типу белка. Указаны десятки протяженных альфа-спиралей, а в структуре белка их нет 


          https://img-fotki.yandex.ru/get/70180/158289418.3aa/0_16e4a1_e241f524_orig.png
          Очень любопытный тип программной спирали



          [21:56:06] Кушелев Александр Юрьевич: Я сейчас пишу о прямой альфа-спирали, состоящей из 22 аминокислотных остатков
          [21:56:21] Кушелев Александр Юрьевич:

          https://img-fotki.yandex.ru/get/176331/158289418.3a9/0_16e469_468e8c12_L.png

          [21:58:49] Кушелев Александр Юрьевич: Вероятность случайного образования прямой альфа-спирали из 22 ао = как 44 раза монетка упадёт на "орла"
          [21:59:14] Кушелев Александр Юрьевич: Если Вы думаете, что это вероятно, попробуйте 



            Формы, механизмы, энергия наномира. Сообщение 83 439

            Skype:

            [28.11.2016 20:25:50] *** Кушелев Александр Юрьевич отправил контактные данные каштан. ***
            [16:42:43] каштан: у вас на этой картинке

            http://img-fotki.yandex.ru/get/9229/158289418.af/0_ae26a_4c84e562_S.gif
            что изображено ?
            [17:36:39] Кушелев Александр Юрьевич: Кольцегранная и упрощённая (многогранная) динамическая модель аминокислоты
            [17:37:48] каштан: пять атомов ?
            [17:37:51] Кушелев Александр Юрьевич: Да. Это глицин
            [17:38:10] каштан: какие пять атомов ?
            [17:40:57] каштан: https://ru.wikipedia.org/wiki/%D0%93%D0 … 0%B8%D0%BD
            здесь написано про шесть атомов
            [17:41:02] Кушелев Александр Юрьевич: NCCOO
            [17:41:09] Кушелев Александр Юрьевич: Да, это они
            [17:42:00] каштан: глицин это NHHHOO
            вы что-то другое написали
            [17:42:33] Кушелев Александр Юрьевич: Водород не показан
            [17:42:45] Кушелев Александр Юрьевич: Только атомы углерода, азота и кислорода
            [17:43:01] Кушелев Александр Юрьевич: NCCOO
            [17:44:45] каштан: почему атомы одинаковых размеров ?
            [17:45:43] Кушелев Александр Юрьевич: Потому что разных
            [17:45:47] Кушелев Александр Юрьевич: 
            [17:47:19] каштан: на этой картинке атомы под другому соединяются


            https://img-fotki.yandex.ru/get/94893/158289418.3aa/0_16e614_af415f61_XL.jpg
            [17:48:39] Кушелев Александр Юрьевич: Одни и те же атомы углерода могут соединиться в алмаз и графит
            [17:49:06] каштан: в смысле вкладываются друг в друга
            [17:50:35] Кушелев Александр Юрьевич: Нет
            [17:50:50] каштан: кислород в полтора раза больше углерода - на вашей картинке этого не видно
            [17:52:16] Кушелев Александр Юрьевич: Углерод может иметь разный размер в зависимости от условий. Он может быть многогранным и сопряжённым
            [17:55:02] каштан: вы говорите о группе атомов
            сами атомы одного элемента одинаковые с незначительными отличиями по изотопам
            ещё раз
            атом углерода в полтора раза меньше атома кислорода
            [17:55:29] каштан: соколик вам об этом говорила
            [17:55:37] Кушелев Александр Юрьевич: Один и тот же атом углерода может иметь разные размеры и форму
            [18:04:37] каштан: ATG - это метионин ?
            https://en.wikipedia.org/wiki/Methionine
            в состав которого входит сера ?
            [18:05:27] Кушелев Александр Юрьевич: Да
            [18:05:57] каштан: атом серы в три раза больше атома углерода
            [18:06:30] каштан: и в два раза больше кислорода с азотом
            [18:06:42] Кушелев Александр Юрьевич: И так бывает
            [18:07:03] каштан: в вашей модели все атомы одинаковые ?
            [18:07:57] Кушелев Александр Юрьевич: Нет. Даже один атом углерода может иметь сильно разные размеры. Я уже писал выше
            [18:09:23] каштан: атом углерода может иметь размеры атома серы и в результате программа строит модель из атомов одинаковых размеров ?
            [18:13:12] Кушелев Александр Юрьевич: Какие же это одинаковые размеры?


            https://img-fotki.yandex.ru/get/174613/158289418.3a5/0_16d603_ed6fe55c_XL.png


            [18:14:11] Кушелев Александр Юрьевич:


            http://img-fotki.yandex.ru/get/6305/126580004.56/0_bd389_21b12eb4_S.gif
            [18:15:25] Кушелев Александр Юрьевич: Зеленые и красные могут быть атомами углерода (+водород)
            [18:20:45] каштан: в этой модели

            http://img-fotki.yandex.ru/get/5414/126580004.3d/0_b0f20_2c87f90a_orig.gif
            все атомы выглядят одинаковыми
            соколик говорила о том что ваша программа не учитывает межатомные расстояния (размеры атомов)
            найти это сообщение не представляется возможным потому что у вас на форуме нет поиска
            [18:22:08] Кушелев Александр Юрьевич: Во-первых, на форуме поиск есть, но для зарегистрированных пользователей.
            [18:22:34] Кушелев Александр Юрьевич: Во-вторых, я Вам уже показал, что даже один атом углерода может иметь разные размеры. Причём сильно разные.
            [18:24:36] Кушелев Александр Юрьевич: Виктория говорит о том, что в моей программе не учтены изменения радиусов внешних электронов. Это действительно так. Но радиусы колец-электронов, например, для ионов кислорода, хлора и фтора отличаются меньше, чем на процент. У Виктории размеры электронов/граней отличаются на порядок больше, т.е. ошибочно. Поэтому моя программа хоть и упрощённая, но раз в 10 точнее 
            [18:27:51] Кушелев Александр Юрьевич: Но это только по радиусам электронов. Если говорить о вторичной структуре, то тут уже различие в точности принципиальное. Ведь у Виктории по кодам "1" и "4" строится прямая спираль с шагом 3 аминокислотных остатка на виток. А большинство спиральных участков имеет 3.6 аминокислотных остатка на виток. При этом фазовый набег приводит к тому, что спиральные участки у Виктории повёрнуты не на те углы, поэтому все модели белков "в раскоряку" 


            Кушелев на CASP - неудобный конкурс, неудобный конкурсант
            https://nano-world-articles.nethouse.ru/articles/313527
            Подборка материалов



            Victoriy пишет:

            Виктория слегка подпортила таблицу;

            Кушелев: Тут два варианта. Либо Виктория слегка подпортила таблицу, либо Виктория легко кинет монетку на "орла" 44 раза подряд 



            Victoriy пишет:

            У Виктории размеры электронов/граней отличаются на порядок больше, т.е. ошибочно.

            Кушелев: Сначала я определил радиусы кольцевых электронов из рефрактометрических радиусов ионов кислорода, хлора и фтора (Работа Гольдшмидта 1923г). Для ионов кислорода, хлора и фтора отличие радиусов электронов не превышало 1%. Позднее радиусы электронов удалось уточнить масштабированием белковых молекул. Ведь макромолекулы белка могут иметь гигантские размеры в масштабах микромира. Я подобрал размер кольцевого электрона таким образом, чтобы размеры белковых молекул, определённых экспериментально совпали с кольцегранными моделями в программе PiMol и HyperChem.
            Совпадение размеров макромолекул получилось при диаметре кольца-электрона 1.7А.



            Действительно, атом серы в том же метионине 

            или цистеине существенно больше атома углерода, там внешние электроны раздвинуты предвнешней оболочкой, но это - радикал, который не влияет на параметры белковой "цепи". Ведь параметры белковой "цепи" определяются геометрией пептидной группы. Согласны?



            Открыт новый тип белковой структуры - метиониновая спираль

            *

            *



              Пикотехнология белков, ДНК, РНК - 2

              http://www.myshared.ru/slide/643151/

              Цитата: 15  МЕТИОНИН - незаменимая АМК. Необходима для синтеза белков, участвует в реакциях дезаминирования, является источником серы для синтеза цистеина. Метионил-тРНК участвует в инициации трансляции. Метильная группа метионина - мобильный одноуглеродный фрагмент, используемый для синтеза ряда соединений в реакциях переноса этой группы на соответствующий акцептор (реакция транс- метилирования) Метильная группа в молекуле метионина прочно связана с атомом S, поэтому непосредственным донором этого одноуглеродного фрагмента служит активная форма метионина - S-аденозилметионин (SAM) 
              16  S-аденозилметионин (SAM) - сульфониевая форма метионина, образующаяся при его присоединении к молекуле аденозина (продукта гидролиза АТФ) Реакция активации метионина Присутствует во всех типах клеток Структура (S + -CH 3 ) в SAM - нестабильная группировка, определяющая высокую активность метильной группы (отсюда термин «активный метионин»). Это уникальная реакция, единственная, в результате которой освобождаются все три фосфатных остатка АТФ. Отщепление метильной группы от SAM и перенос ее на соединение -акцептор катализируют метилтрансферазы в реакциях транс- метилирования. SAM в ходе реакции превращается в S-аденозилгомоцистеин (SAГ). 
              Конец цитаты.

              Кушелев: Понятно. Связь Met-Cys косвенно подтверждается, т.к. Cys образуется из Met, а значит, что в мышином лизоциме тоже возможно превращение Met в Cys в процессе дозревания белка.

              https://img-fotki.yandex.ru/get/196070/158289418.3c3/0_17074a_a85f2577_XL.gif



              Открыт новый тип белковой структуры!

              http://nanoworld.org.ru/post/82432/#p82432

              >NM_207361.5 Homo sapiens FRAS1 related extracellular matrix protein 2 (FREM2), mRNA
              GGGATTTCCCTCAAAGCCCAGGGTCCGGGGACCTGGAAAGTAGAAGTGGAGGGATTCAATTCTCCGCGCG
              ATTGAGGCGCTAGCGGCGGAGCTGGACGGCCTGGGAAGGCTTCGGCTCCTCGGCTGCGGCTCCAGCCCGG
              ACGGCGCCGCGCAACTTTGCCATCCTTCTGGCCCAGCCCCGGCTACAGGAGGACCCCGCGGGCAACGCGC
              GGAGTTCCTGGCACTTCCCGGCGGTGTCTCTTGTTGTCTGCCCGGGGACCGACTTCGCATGCTCTCAGGC
              TGACCTGTCCAAGCCCGAACACCGGGACCATGCACTCAGCCGGGACTCCCGGGTTATCCTCGCGCCGGAC
              AGGCAACTCCACCAGCTTTCAACCAGGACCGCCACCGCCGCCCCGGCTGCTGCTGCTGCTGCTGCTTCTC
              CTGTCACTGGTAAGCCGCGTCCCGGCACAGCCCGCTGCCTTCGGCAGGGCGTTGCTGTCCCCTGGTCTCG
              CGGGGGCTGCAGGGGTCCCTGCTGAGGAGGCCATAGTGCTGGCGAACCGCGGACTCCGGGTGCCTTTCGG
              CCGTGAAGTCTGGCTGGATCCCCTGCATGACCTGGTGTTGCAGGTGCAGCCCGGGGACCGCTGCGCGGTT
              TCGGTACTAGACAACGACGCACTGGCCCAGCGACCGGGCCGCCTGAGTCCCAAGCGCTTCCCGTGCGACT
              TTGGCCCTGGCGAGGTGCGCTACTCTCACCTGGGCGCGCGCAGCCCGTCTCGGGACCGCGTCCGGCTGCA
              GCTGCGCTATGACGCGCCCGGAGGGGCAGTAGTGCTACCACTGGTACTGGAGGTGGAGGTGGTCTTCACC
              CAGCTGGAGGTTGTGACTCGGAACTTGCCTCTGGTCGTGGAAGAGCTGCTGGGGACCAGCAATGCCCTGG
              ACGCGCGGAGCCTGGAGTTCGCCTTCCAGCCCGAGACAGAGGAGTGCCGCGTGGGCATCCTGTCCGGCTT
              GGGCGCGCTGCCTCGCTATGGAGAACTCCTCCACTACCCGCAGGTCCCTGGAGGAGCCAGAGAGGGAGGC
              GCCCCGGAGACTCTCCTGATGGACTGCAAAGCTTTCCAGGAACTAGGCGTGCGCTATCGCCACACAGCCG
              CCAGTCGCTCACCAAACAGGGACTGGATACCCATGGTGGTGGAGCTGCGTTCACGAGGGGCTCCTGTGGG
              CAGCCCTGCTTTGAAACGCGAGCACTTCCAGGTTCTGGTGAGGATCCGAGGAGGGGCCGAGAACACTGCA
              CCCAAGCCCAGTTTCGTGGCCATGATGATGATGGAGGTGGACCAGTTTGTACTGACGGCCCTGACCCCAG
              ACATGCTGGCAGCCGAGGATGCTGAGTCTCCCTCTGACCTGTTGATCTTCAACCTTACTTCTCCATTCCA
              GCCTGGCCAGGGCTACTTGGTGAGCACCGATGATCGCAGCCTGCCCCTTTCCTCCTTCACTCAGAGGGAT
              CTGCGGCTCCTGAAGATTGCCTACCAGCCCCCTTCTGAAGACTCTGACCAGGAGCGCCTCTTTGAACTGG
              AATTGGAGGTAGTGGATCTAGAAGGAGCAGCTTCAGACCCTTTTGCCTTCATGGTAGTGGTGAAGCCCAT
              GAACACAATGGCTCCGGTGGTCACCCGGAATACCGGTCTTATTCTCTATGAGGGTCAGTCTCGGCCCCTC
              ACAGGCCCTGCAGGCAGTGGTCCGCAAAACTTGGTCATCAGCGATGAGGATGACCTAGAAGCAGTGCGGC
              TAGAGGTGGTGGCTGGGCTCCGGCATGGTCACCTTGTCATTCTGGGTGCTTCCAGTGGCAGCTCTGCTCC
              CAAGAGCTTTACAGTGGCTGAGCTGGCAGCCGGCCAGGTGGTCTACCAGCATGATGACAGAGACGGCTCG
              CTGAGCGACAACCTGGTGCTTCGCATGGTGGATGGAGGAGGCAGGCACCAGGTACAGTTTCTGTTCCCCA
              TCACCTTAGTGCCTGTGGATGACCAGCCACCTGTTCTCAATGCCAACACGGGGCTGACACTGGCAGAGGG
              TGAAACAGTGCCCATCCTGCCCCTTTCCCTGAGTGCAACTGACATGGATTCAGATGATTCTCTGCTGCTT
              TTTGTGCTGGAGTCACCCTTCTTAACTACGGGGCATCTGCTTCTCCGCCAAACTCACCCTCCCCATGAGA
              AGCAGGAACTTCTCAGAGGCCTTTGGAGGAAGGAGGGGGCATTTTATGAGCGAACAGTGACAGAGTGGCA
              GCAGCAGGACATAACAGAGGGCAGGCTGTTCTATAGACACTCTGGGCCCCATAGTCCTGGGCCAGTCACA
              GACCAGTTCACATTTAGAGTCCAGGATAACCATGACCCTCCTAATCAGTCCGGGCTACAGCGGTTTGTGA
              TTCGTATCCATCCTGTGGATCGCCTCCCTCCGGAGCTGGGCAGTGGCTGTCCCCTTCGTATGGTGGTACA
              GGAATCCCAGCTCACACCACTGAGGAAGAAGTGGCTGCGCTACACTGACCTGGACACAGATGACCGAGAA
              CTACGTTACACAGTGACTCAGCCCCCCACAGACACAGACGAAAATCACCTGCCAGCCCCACTGGGTACCT
              TGGTCTTGACTGACAACCCCTCAGTCGTGGTGACCCATTTTACCCAAGCCCAGATCAACCATCATAAAAT
              TGCTTACAGACCCCCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTTCCAGTTCCAGGTGGAA
              GACCGAGCTGGGAATGTGGCTCCAGGTACCTTTACCCTTTACTTGCATCCCGTGGACAACCAGCCACCTG
              AGATCCTCAACACCGGCTTCACTATTCAGGAGAAGGGTCACCACATCCTGAGTGAGACAGAGTTGCACGT
              GAATGATGTAGACACTGATGTTGCCCATATCTCTTTCACTCTCACTCAGGCACCCAAACATGGCCACATG
              AGAGTGTCTGGACAGATCCTGCATGTAGGGGGTCTCTTCCACTTGGAGGACATAAAACAGGGCCGAGTTT
              CCTATGCCCATAATGGGGACAAGTCCCTGACTGATAGCTGCTCCTTGGAAGTCAGTGACAGACATCATGT
              GGTGCCCATCACTCTCAGAGTAAATGTCCGGCCAGTGGATGATGAAGTGCCCATACTGAGCCATCCTACT
              GGCACTCTGGAGTCCTATCTAGATGTCTTAGAAAATGGGGCTACTGAAATCACTGCCAATGTTATTAAGG
              GGACCAATGAGGAAACTGATGACTTGATGTTGACTTTCCTCTTGGAAGATCCACCTTTGTATGGGGAAAT
              CTTGGTCAATGGCATTCCAGCAGAGCAGTTTACTCAAAGGGACATCTTGGAGGGCTCTGTTGTATATACC
              CACACCAGTGGTGAGATAGGCCTATTGCCTAAAGCGGATTCTTTTAACCTGAGTCTGTCAGATATGTCTC
              AAGAATGGAGAATTGGTGGCAATACTATCCAAGGAGTTACTATATGGGTGACCATCCTGCCTGTTGATAG
              CCAGGCCCCAGAAATCTTTGTAGGTGAACAGTTGATAGTAATGGAAGGTGATAAAAGTGTTATAACATCA
              GTGCATATAAGTGCTGAAGATGTCGACTCCCTGAATGATGACATCTTGTGCACTATAGTTATTCAGCCTA
              CTTCAGGTTATGTTGAAAACATTTCTCCAGCACCAGGCTCTGAGAAATCAAGAGCAGGGATTGCCATAAG
              TGCTTTCAACTTGAAAGATCTCAGGCAGGGCCACATAAACTATGTCCAGAGTGTCCATAAAGGGGTGGAA
              CCTGTGGAGGACCGATTTGTATTTCGTTGTTCTGATGGCATTAACTTTTCAGAGAGACAGTTCTTCCCCA
              TTGTAATCATTCCCACCAATGATGAACAGCCAGAGATGTTTATGAGAGAATTTATGGTGATGGAAGGCAT
              GAGTCTGGTAATTGATACACCCATTCTCAATGCTGCTGATGCTGATGTTCCCCTGGATGATTTAACTTTC
              ACTATTACCCAATTCCCCACTCATGGTCACATCATGAATCAGCTGATAAATGGCACGGTTTTGGTCGAAA
              GCTTCACCTTGGATCAGATCATAGAGAGTTCCAGCATTATTTATGAGCATGATGACTCCGAGACCCAGGA
              AGACAGTTTTGTGATTAAACTAACAGATGGGAAGCACTCTGTGGAAAAGACGGTCCTCATTATAGTTATC
              CCTGTTGATGATGAGACGCCCAGAATGACTATCAATAATGGACTAGAAATAGAAATTGGGGATACCAAGA
              TTATCAACAACAAAATATTAATGGCAACAGATTTAGATTCAGAAGACAAATCTTTGGTTTATATTATTCG
              TTATGGGCCAGGACATGGCTTATTACAGAGACGAAAACCTACTGGTGCCTTTGAAAATATCACACTGGGC
              ATGAATTTTACCCAGGATGAAGTAGACAGAAACTTAATTCAGTATGTCCATTTGGGGCAAGAGGGCATTC
              GGGACCTAATTAAATTTGATGTGACTGATGGAATAAATCCCCTCATAGATCGTTACTTTTATGTGTCCAT
              CGGGAGCATTGACATTGTCTTCCCTGATGTGATAAGTAAGGGAGTGTCCTTGAAAGAAGGTGGCAAAGTC
              ACTCTTACAACAGACCTACTAAGCACTAGTGACTTGAACAGTCCTGATGAAAACTTGGTTTTTACCATCA
              CCAGGGCTCCCATGCGAGGTCACCTGGAATGCACGGATCAGCCTGGTGTGTCCATCACGTCTTTCACTCA
              GCTGCAACTGGCTGGAAACAAAATCTACTACATCCACACAGCTGATGATGAAGTGAAAATGGACAGTTTT
              GAGTTTCAAGTCACCGATGGACGTAACCCTGTCTTTCGGACATTCCGTATCTCCATTAGCGATGTGGACA
              ATAAAAAGCCAGTGGTCACCATCCACAAGCTGGTTGTCAGTGAAAGTGAAAACAAGCTGATTACTCCTTT
              TGAGCTCACTGTCGAAGACAGAGATACTCCTGACAAGCTCCTGAAATTCACTATCACCCAGGTGCCTATT
              CATGGCCATCTCCTATTCAACAATACCAGACCTGTCATGGTTTTTACCAAGCAAGACTTGAATGAAAACT
              TAATCAGCTACAAACATGATGGCACTGAGTCAAGTGAAGATAGCTTCTCCTTCACAGTGACTGATGGCAC
              CCATACAGACTTCTATGTTTTTCCTGATACGGTGTTTGAAACAAGGAGACCCCAAGTGATGAAGATCCAG
              GTCTTGGCTGTTGACAACAGTGTCCCCCAAATCGCAGTGAATAAGGGGGCCTCTACACTTCGCACTCTAG
              CCACTGGCCACTTGGGGTTCATGATCACAAGCAAAATATTGAAAGTGGAGGACAGAGACAGCTTACACAT
              TTCTCTTAGATTTATCGTGACAGAGGCCCCTCAACATGGATATCTTCTCAACCTGGACAAAGGCAACCAC
              AGCATCACTCAGTTCACACAAGCTGACATTGATGACATGAAAATATGCTATGTCTTAAGAGAAGGGGCTA
              ATGCCACAAGTGATATGTTCTATTTTGCAGTTGAAGATGGTGGTGGAAACAAGTTAACGTACCAGAATTT
              TCGTCTGAATTGGGCATGGATCTCCTTTGAAAAGGAATATTACCTGGTCAATGAGGACTCCAAATTTCTA
              GATGTTGTTCTTAAACGTAGAGGTTACTTGGGAGAAACTTCTTTTATAAGTATTGGCACAAGAGACAGAA
              CTGCAGAAAAAGACAAAGACTTCAAGGGCAAAGCACAGAAACAAGTGCAGTTCAACCCAGGCCAGACCAG
              GGCCACATGGCGAGTGCGGATCCTGAGTGATGGGGAGCATGAGCAGTCTGAAACCTTTCAGGTGGTACTC
              TCAGAGCCCGTGCTGGCTGCCTTGGAATTCCCCACAGTCGCCACTGTTGAGATCGTTGATCCAGGAGATG
              AGCCAACTGTGTTTATTCCCCAGTCCAAATACTCCGTTGAAGAAGATGTTGGTGAGCTGTTCATTCCCAT
              CAGGAGGAGCGGAGATGTGAGCCAGGAGTTGATGGTGGTCTGTTATACCCAACAAGGAACAGCAACTGGA
              ACTGTGCCGACTTCCGTGTTGTCTTACTCTGATTACATATCCAGGCCTGAGGACCACACCAGTGTTGTCC
              GCTTTGACAAAGATGAACGGGAGAAACTGTGTCGGATAGTCATAATTGATGACTCTTTGTACGAGGAGGA
              GGAAACCTTCCATGTCCTTCTGAGCATGCCCATGGGGGGAAGAATCGGATCAGAGTTCCCAGGGGCTCAA
              GTTACAATCGTTCCTGACAAAGATGATGAACCCATCTTTTACTTCGGTGATGTGGAATACTCTGTGGATG
              AGAGTGCTGGCTATGTGGAAGTGCAGGTGTGGAGAACGGGCACTGACCTGTCCAAGTCTTCTAGTGTCAC
              AGTGAGGTCTCGGAAAACAGATCCTCCCTCTGCAGATGCTGGAACAGACTATGTGGGCATCAGCCGTAAT
              TTAGATTTTGCACCTGGAGTCAACATGCAGCCTGTTCGTGTTGTCATTCTGGATGACCTTGGACAACCAG
              CGCTGGAGGGAATTGAGAAATTTGAACTGGTGCTTCGCATGCCTATGAACGCAGCCCTTGGCGAGCCCAG
              CAAAGCCACAGTGTCCATAAATGACTCTGTCTCCGATTTGCCTAAGATGCAATTCAAAGAACGAATATAT
              ACTGGCAGCGAAAGTGATGGGCAGATAGTTACAATGATCCATAGGACTGGGGATGTCCAGTACAGATCTT
              CAGTGAGATGCTACACCCGGCAGGGGTCTGCACAGGTGATGATGGACTTTGAAGAACGCCCAAACACTGA
              TACCTCCATCATCACATTCCTCCCTGGTGAGACAGAAAAGCCCTGCATTCTTGAGCTGATGGACGATGTG
              CTCTATGAGGAGGTAGAGGAGCTCCGCCTGGTACTCGGCACTCCACAAAGCAACTCTCCCTTTGGGGCTG
              CAGTTGGTGAACAAAATGAAACTCTCATAAGGATCCGAGATGATGCTGATAAGACTGTTATTAAATTTGG
              AGAAACCAAATTTAGTGTCACTGAACCCAAAGAACCTGGAGAGTCGGTGGTTATAAGAATTCCAGTGATT
              CGCCAAGGAGACACTTCAAAGGTTTCCATTGTGAGAGTCCACACCAAGGATGGCTCGGCCACCTCTGGAG
              AAGACTACCACCCTGTGTCAGAAGAAATTGAGTTTAAGGAAGGGGAAACCCAGCACGTGGTTGAAATCGA
              AGTTACCTTTGACGGGGTGAGAGAGATGAGAGAGGCCTTCACTGTTCACCTAAAACCTGATGAAAATATG
              ATAGCAGAGATGCAGTTGACGAAAGCCATTGTGTACATAGAAGAAATGAGCAGCATGGCAGATGTCACTT
              TTCCTTCTGTCCCTCAAATTGTATCCCTGTTGATGTATGACGACACTTCCAAAGCTAAGGAGAGTGCTGA
              ACCCATGTCTGGCTATCCTGTCATCTGTATCACAGCTTGCAACCCCAAATATTCAGACTACGATAAAACA
              GGCTCTATCTGTGCAAGTGAGAACATCAATGACACTTTGACGCGGTACCGGTGGCTGATTAGTGCACCTG
              CGGGCCCTGACGGTGTGACCAGCCCTATGAGAGAAGTGGACTTCGACACCTTTTTTACGTCATCCAAGAT
              GGTCACACTGGACTCCATATACTTTCAGCCTGGCTCCCGGGTACAGTGCGCAGCTCGTGCTGTGAACACC
              AATGGGGATGAAGGCCTGGAGCTCATGAGCCCTATTGTAACCATCAGCAGAGAAGAAGGTCTTTGTCAGC
              CCCGTGTACCTGGGGTTGTTGGAGCAGAGCCGTTCTCAGCTAAATTGCGCTACACAGGCCCTGAGGATGC
              AGACTACACAAACCTTATCAAGCTCACTGTCACAATGCCACACATAGATGGCATGCTCCCCGTGATCTCC
              ACTAGAGAGCTTTCCAACTTTGAGCTCACCCTCAGCCCTGATGGCACAAGAGTTGGAAACCACAAGTGCT
              CCAACCTCCTGGATTATACTGAAGTGAAGACTCATTATGGTTTCTTGACTGATGCTACCAAAAATCCAGA
              AATAATTGGAGAGACATATCCTTACCAGTACAGCTTGTCCATCAGAGGTTCCACTACCTTGCGCTTCTAC
              CGGAACCTGAACCTAGAGGCCTGTTTATGGGAGTTCGTTAGCTACTATGACATGTCAGAACTCCTTGCTG
              ACTGTGGTGGCACCATTGGAACAGATGGACAGGTCCTAAACCTAGTGCAGTCCTATGTGACCCTTCGAGT
              CCCTCTGTATGTTTCCTACGTGTTCCATTCCCCCGTGGGGGTAGGAGGCTGGCAGCATTTTGACTTGAAG
              TCAGAGCTTCGTCTAACTTTTGTGTACGACACCGCCATCTTGTGGAATGATGGAATTGGCAGCCCCCCAG
              AGGCTGAACTTCAAGGTTCTCTCTATCCAACCAGCATGCGCATCGGTGATGAGGGGCGCTTGGCCGTGCA
              CTTCAAGACAGAGGCTCAGTTCCATGGCTTATTTGTGCTGTCACATCCCGCATCCTTTACAAGCTCAGTG
              ATCATGTCAGCTGATCATCCAGGCCTGACATTTTCCCTCCGCCTCATAAGGAGTGAACCAACCTATAACC
              AGCCAGTACAGCAGTGGAGCTTTGTCTCTGACTTTGCCGTACGTGACTACTCAGGGACCTATACTGTGAA
              GCTGGTGCCATGCACTGCCCCATCACATCAGGAATACCGCCTGCCAGTCACCTGCAACCCCAGAGAACCT
              GTCACCTTTGACCTTGACATCCGATTCCAACAGGTCAGTGATCCAGTGGCTGCTGAGTTTAGCTTGAACA
              CCCAAATGTACCTGCTCTCTAAGAAGAGTCTCTGGTTGTCTGATGGATCCATGGGATTCGGGCAAGAGAG
              TGATGTTGCTTTTGCAGAAGGTGATATAATTTATGGTCGTGTCATGGTGGATCCTGTCCAGAATCTGGGT
              GACTCCTTTTACTGCAGCATTGAGAAGGTGTTTCTATGCACTGGAGCTGATGGCTATGTTCCCAAGTATA
              GTCCAATGAATGCAGAATATGGCTGCTTAGCCGACTCTCCTTCACTCTTATATAGATTTAAAATTGTGGA
              CAAAGCTCAGCCAGAGACACAAGCGACCAGTTTTGGAAATGTCCTATTTAATGCCAAACTAGCAGTGGAT
              GACCCTGAAGCCATTCTCTTAGTGAATCAGCCTGGATCTGATGGATTTAAAGTCGACTCAACACCACTCT
              TTCAGGTCGCTCTAGGCCGAGAATGGTATATACATACGATCTATACAGTGAGATCGAAAGACAATGCCAA
              TCGAGGTATTGGCAAAAGAAGTGTGGAGTACCATTCTCTGGTGAGTCAAGGAAAGCCCCAATCCACCACC
              AAGAGCCGGAAGAAGAGAGAGATCAGGAGCACACCCTCACTGGCATGGGAGATTGGTGCTGAAAACAGTC
              GAGGAACAAACATCCAGCACATTGCCCTGGACCGCACCAAGAGGCAGATCCCCCATGGGAGAGCACCTCC
              AGATGGCATCCTCCCCTGGGAGCTCAACAGCCCCAGCTCTGCAGTCAGCCTGGTCACTGTGGTGGGAGGC
              ACCACGGTAGGGTTACTCACCATCTGCCTCACTGTCATTGCAGTGCTGATGTGCAGGGGCAAGGAAAGTT
              TCAGGGGGAAGGATGCCCCGAAAGGCTCCAGCAGCAGTGAGCCCATGGTGCCCCCACAGAGCCATCACAA
              TGACAGCTCAGAAGTTTGATGACTGCAGGTAGAATTCAACCTTTTCCGTAAGTGCCTCGGAAAAGATCAC
              AATGGAACCTTAAATACTTCTGGTAAACCATAGAGAATGGAGGATGGCTGTGATGAAGCTGCTTAGAGAA
              TATGACTGTACTAATGGAGTTTGATTTGAATTCTCCATACTCTTTTTTGCATCAAAGGACAAATTAAGGC
              ATCTTTCCTCTTGCCCCAAAGGCAGCAACAACGTACTCATATGTACACAGAGCCATGATGTGAGGAATGT
              ACTCCTCATTTTAGACATATTCTCTATGCAGTGGAGATAAATCTATTAAAAGGTGCTAACAGACTCTCTT
              ACAAGTGTAAGAGGAATCTACTGTTGCTATGTTAGTGTGAATGTTGAAGGTGCAATTATCACATTGTTTA
              TTAATTGTATAACAGATTATTACTAGAAAGGTTTTTGTTGCTAGTCTGGAAAACTGGTGAACACACTGTT
              TATTATGACAAGTTTTCAAATAGGTGAAGACAGCATAGAATTATGACCAGGGTGGCTCAACCCACAAATC
              AACTGATCTACTACTTGGGAGACAGTGGAAGGAAAGATAGAGGGAAGGAAGTTCACTCACTTGAATTTGA
              ATTGCTTCTCATTCTCATCAGACTCTCCTTGTTTTGTTTGCATATTTAATTTTAAATTAAACCAAAGAAT
              ATGTTAATTCTGAAAGAGATTTTTAAGAGATGCTGCTCTGTTTTGGCATATAGTGAGTAATGGTAGAGCT
              CTTGCATGGTAATATACCTTATTGGTGCTCAACATTTGTGGGAAATTAGAGGGTTGGTGAGATTTTGGTG
              ATGAATAAATGCCATAGAGTTAGAGTCACTACAAGACAATGTTCTCTAAGAACTGAGCCTAGATGTTTGC
              AGTATTGAACCCATAAATGATAATAAGAAACATTGTTACAGATGGTGAAGGGAGAAAGTGGTATTTATTA
              ATATAATGTGTATAATCAGAGTGCCTCTTATACATACTTTATAGAATAAAGGAACATTTTGACAGATGAG
              GTTATCCCTCGGAGTAGCGTAATCACACAATAACATTTAGAACTTAAATTGGCTACAGGACATTTTATTA
              GCTTTCTATCCAGCATCTGGTCCAAACGATGGGACTCTCTGCAACTATCATTCCAGAAATGGTCTTGGAG
              GTGGCCAGAATCATTGACCATATTTTTATTTGGTTCAAGAAGACATCGCTCTGGCATCCCCAGTTCAGTG
              AACTGGTACAATGTGGTCCCTCTCAATATTTAAAAATATAATTTGTAACAGTGCTTACCATTCACCTCCC
              AAAGCCAAGGAACTTGAGTGAGCTTCCTTGGCAAGCCTCCCATTGCCTTTCTGCATCAATGTGTTTGTTA
              CCAAATAGCAGAAATTTCGCTTAGAAGGGGAAAACTTCAGCTTTCCAAAAGCTAGTAAACATGTTTCAAA
              GAAAAATAAGGTCAGGAGAAAAAGAATAATGCCTACAGATTATCCTTCAGATGCTGGCTAGAATCCCCTT
              TGACTTCTAGCCATAAGCTGGCCACATTGGACATCTTGGTCACTGCAGAATTTTAAAAGGCAAACTTCTC
              AGAACAGATGTGCACATCTTAATTTGGTGTCTGTAAGTATCAACCATTTCTTGATCAAGATAAGGAAGCA
              ACACTGATACTGAGAGAGAGGTCATATGTCCAATAGTTGCCTTTCTTCTCTTAGGCAGCTCTGCACTTCA
              TGTTCAGTTTTTTAAAAATAGACTGTAGTATCCTTTCATTGGAGAATTTACAAAAATATCATCTACAGCT
              CAAAAGTCCCACTAACGGCTTATATGAACAGAAAGTACTGTGTAGCCCAGGAGTTTATTTAGCAAGATAA
              ATAGTGGTAATTTCTTAATCATTCCCCTTTCCTTTGCTTTACCTTCTGGCAGATGCTTAGCTACTTCTTT
              GGCTACCTCATAATTTGTATGGGAATGAACATGAATTAGGGAACTTCAAATAGTGCGTAGACTTTTCCCT
              ACTTACCATTGGGTTCAATTGATGTAGACTGTTAGAGCAAGTATACTCAATCAACTTGCTGATATTTTAG
              TAGTTAACAGCTTCCGAGCCTATCATGCAATTTGGAGTCTGTCAATGAATATAGCAATCGGTGAAGCATT
              ACTGTACGAAGTCTGTTTTCAGGCTTTGGGTCAAGCTGGTTTTATACCAAATTTCACTCTACAATGCATA
              TTCTAATGAAGCTACTTTATATAAATTGGAGAGCTTATAAAATGCAGAACATTTCTATCCTATCCTACCA
              AATATTTATCCTTCTCTGTCCTCTATTCTCTTACTCTCCTCTCTCCCTTTTTCCTTCCCTTTATTCCCTT
              GAAAAAAGAGAATCTGTGGGAAATAGGCAGATATAGCTTTTTAAAATATAAAGTACTTGGGATTTTGCAT
              TATTTTTCTTAATATCTATTTACTAAGTATGTAATTTAATATACATTAATTATTTTTTGAAACTCTTGTT
              AGTGGGAAGAATATGGTAAATTTTTTGTTAAATAAAATAGACCCTTATGTTTAGCATTTTGTTTTTAGAG
              AACTATTCTGGTACTATCAGAACAAATACATAAAATAACTTCCCATAGAGAACAGGATATAGCAATAATA
              GCTCCTTAGATACTCAGTGGCTTCTGACTCCAATCAAGGTCTTGTTGATATTATATAGTAAAAATAAAAC
              CAAAAATAAATATTATTCAAGTGGCTCTTCTAAGCATGTGAATCATGAAGCACTGAAATATGTATTTTAA
              TGATGATCTTATTTATTCCCATTTTTGCCCTTAGTTAACATTTACTGGTGCTCACCTAGGATTGGCTATT
              CTGAGGGATTGCATAGAAACCAAGCTCCACTTGCTGTCCTTGGGAAGGTTATAACTGAATGCAGCTCTTT
              ATTTGGACTAAAGTGTCAGGATATGCATTAGATTCTCTCCTGAACCAAAAACACAACAGTCATTATCTGT
              GAACCATAATTTAAAAATCTTTCTAGAATAACAACAGCAGACTCCACTCTTGTTTGTCTAAAAGAGCCCT
              ACTGGGTATGGATCATTCTGATGACAGATTTATACAAAATGATTCAAACCAGTAACTTAGTAAAATTGAC
              CTTCGCAAAACCTCACTGGGGGAGTGCCTTGTAGAGCTGTGGGTGGGACTGCACATTCTTTTCCTCTTAG
              TAAAAGATAGGCCCACTTTATTCCAAGAATAACACTTAGCACATAAACTCTTCTTCCAGCTCGTTAGCAG
              CATTAGCACCTTCTGAATTCCACCCTCTCAGAAGAATCCACAGTGTTTGAACAATTTGCATAAAGGTCAG
              CTAGCATCCTGCTGCCAAGCCACTGCATAGCATTTGTGATAAGAAGGACCAACTCTAGGCTCAATATGAA
              GGGATTTAGTTCTGTAAGCAGCAAAAAAGCTTCTTTATCAAGTCATCTTACCTCTAATTCTTTTCCAGTG
              TGCCAACTCCAAAGTCAACATTAAAAATGTAAATGGACCTGTGTAAATATCACAGAGAGCTTTTCCTTAT
              ACATCTCAATGCTGAGAGTTAAAATATTCCCAGGTTAAAATTTTTTTAAAGTACCAATAATAGAGCTAAA
              TACAATGACATTTGCTTTTAAAAGGTGGATATTTTATTTCTGCTTTTTGAAAATACTTATTTAGTATTGA
              CTTGGAAGCCAATTTGGTCCTTTAATAAGTAAAGAAAATAATATGTTTAAAAATGTAAATGTTTTACAAA
              TTTGAAACTTTCATAATTGTATTAATCAGAAAACAAGCACATTGCCATTCTTTGAAACTCATGTTTCTAG
              ACATGACAGCAGTAATAAAAGGATGAAAACAAGTGTCTTCACTAAGCGTATGGCCAATAAATGGGACCCA
              AACGTTCAATCTGTTCAGTTTACCAAGGTTCAGAAATACGTAATTTAGCAGGAAACTATAAATACCAGTG
              CTATCACAGCCACACATACACACACACAGACATAAAATAACCAAACATCTCATTTCTAGGAAAGAGATAA
              CACTAAAGGCATCATAGGTTTAACTGAAATACGTTATATGAAGTTTTACAAAAAGGTCAACAGAAAGCTC
              ATTTGTGAAAACATACTCTCATGGGAGCTTCTTTAACATTAGTTCAGAGGTTAATATATTTCCTGGAGGT
              GTTTTCCTAGAATTGATTGCACTATTGCATGGTAATAACATTTAATTGTTAAGGAAACATTATATATAGG
              TTCAAATTATCCCTTAATGTTGATTTCTCCCCTTTTCCATGGATTTTGATACTAAGAAACAAAATGCTTT
              GAGATTTTGGTAACTATTTTGATTTTGATAAAACATGTTAAAATAGAAGGACATGATATTTTTCTATAGT
              TTCCATCAGGAAGAGTACATCAGAAACTTCTCCATAAGGAAAGAAAACTGACTCTCTCTTGAACTAGTGT
              TGACAAAATACACTAATGTCTTTCTTAATTTTATTTTATTAGGAGAAAAATCAGAATATTAAATTTGCAA
              ACTTTTGAACAGCAGTAATAGCTCCTTAGACACTCAGTATCTTTCTTCCCTATCTTTCAAGCACATTTAA
              TTTCTTTCCCCTGGTATTTGTTTGCTTTGTGTTTTTTCAATATTTTGTTTGCTAAAGAACAATAACAACA
              ACAAAGCTGGTCCAGCCCTGACACCTACTTTTGCTTTTTTTCTTTCTTTCTTTTAATTTGTTGAACTATA
              GGTTTCTTTCTGAGATGTATTTTTCATTCTTCCAATAATGCTCTCTTTTTCATTTCAAAACCATTACCAC
              TTTCAATATGTAATTAACATCCTCATTCATCAGAAAGCTGGTAAGTCCACACAGCATTTGTGCAGTATCC
              CTTCTGTGTAAAATGTTAAGGCTTTCAGATGAAAGAAAAAAGAACTTCCTGCAAAAGATCAAAAGCATCA
              TACTAAATAAAATGATGACAATATGTGCCTTGATTTTTCTCTCAATGGAGGTTCAACATTGACATTTAAG
              ATGTAAAAAAAATTACTTTGATGGTTTAATTAAGAATAATAAGTCAAATATCACATGTATGTAGTTCTTT
              TGGATGACCGAATACCTTAAAATGAACTAAATAACTGAAATAAAGTGTTAAAATGTTAACAGCGTTGAAG
              TTTTTAAAATTATAATTATCAAATGCACAATGTTCTTTTACTATGCCAAATGTTGCCTACACTGATTACA
              TGATTGTCACAGTTTAAGTGAATTTCTACTATGGATCTTTATTTTCCCCAATGTTTGGATCATCCTCTCA
              GATAAGAATTGTCAGTATTGCACCTCAAGAAAGAAGAAAAAATAAGAATGTAAATTTTTAAAAGCTAGCA
              TTAAAAGTAAAGAGCAGTACAATAAAAATCACTTAAAATAGAGAAAGGCAACTACTGAGTAAGAAGAAAA
              GATAATTTCTGTAAAAGCTAAATTTATGCACATTACAAAAAGTAGTCAAGTCAGTCTTCCATTGTGACTT
              CAGGAATTCAAATGCAAGTTGTTGGCAAAATATATATATACACACACACACACATACACACACATATATG
              TACATACATATATATATAGAGAGAGAGAGATAGATTTTTTTTTTTTGAGACAGAGTTTCGCTCTTGTTGC
              CCAGGCTGGAGTGCAATGGAATGATCTTGGCTCACCGCAACCTCCGCCTCCAGGGTTCAAGTGATTCTCC
              TGCCTCAACCTCCTGAGTAGCTGGAATTACAGGTGCCCACTACCATGCCTGGCTAGTTTTTGTATTTTTA
              GTAGAGACAGGGTTTCTCCATGTTGGTCAGGCTGATCTCGAACTCCCAACCTCAGATGATCCTCCCGCCT
              CCACCTCCCAAAGTACTGGAATTACAATGGCGTGAGCCACCACAAGATATTTTTAAAGCCCATTTGTCTA
              TAAAAGAAAACTCTTGGACAAGGAGCTTTGTGTTTTATAATTGTATTACGTGCCTGCTTCCTTACCAAGT
              GCCCTCCATAACACTAAGTAAATTTATATTTATCTAGCCTCTGAGTGACATATCTGTGTGTAATGGAATT
              ATTTGCAGAATTTAATAGCCTTTTTTATTTTCGCATGAGAATTTTTCAAAAACTATCAGGGTCTAGTTTT
              ATCATACATTTACTAAGTTACTACATATTGGTGGATATTGACGTTTATTCCTGGGAATCTAATTTTGCAA
              ACAATTTGGAGCCATTCAGTCATAAATTCATGTCAACAATAAGTCTTGCTGCCGCTTGTGTTTCATAACT
              ACGCTTGCTTTCCTTCAAAATATACCAAGTGTGTAATATAAATAAAGCCCATATCAATATAAAAAAAAAA
              AAAAAAAAA

              Композиционный код 6:

              5,3,5,5,3,5,5,3,4,4,1,1,3,2,3,5,5,2,5,3,3,5,5,3,5,5,3,5,5,2,3,2,5,3,5,5,3,5,3,3,4,4,4,1,1,1,2,5,5,5,
              2,3,5,2,1,1,1,1,1,1,1,1,1,1,1,4,4,2,5,5,2,3,3,5,3,4,4,4,3,5,5,5,3,5,5,2,5,3,5,3,3,1,1,4,1,3,2,1,4,1,
              1,4,1,6,1,2,5,5,3,5,5,3,1,4,1,4,2,1,1,1,1,1,3,3,2,2,5,2,4,4,1,4,4,4,4,4,4,4,3,5,5,2,5,2,1,1,1,4,2,5,
              5,3,1,1,1,1,4,1,4,1,3,3,4,4,4,3,2,5,5,3,3,5,5,5,2,4,4,4,1,1,2,4,4,4,3,5,5,3,3,4,4,4,3,5,5,3,1,4,4,1,
              1,4,1,1,4,1,1,1,4,3,5,2,2,5,5,5,2,5,5,5,2,4,1,1,4,3,1,1,1,1,4,1,1,3,5,3,1,1,4,1,1,3,1,4,1,4,1,1,4,3,
              4,1,1,1,4,4,1,4,1,3,5,5,5,2,5,2,2,5,2,2,5,2,4,1,4,1,4,1,1,1,1,4,1,3,5,3,5,5,5,3,4,4,4,3,1,4,4,4,1,1,
              3,1,4,1,4,4,1,4,1,1,1,1,1,1,1,2,1,1,1,1,4,1,1,4,1,1,1,1,4,4,3,5,3,2,3,1,1,1,1,4,1,1,3,2,2,5,3,5,2,1,
              1,4,1,3,1,4,6,1,1,3,3,5,5,3,2,5,5,5,3,5,5,2,5,5,3,5,2,2,1,1,1,1,2,1,6,4,4,1,4,3,2,2,5,3,3,5,5,5,3,3,
              5,3,1,1,1,1,1,3,4,4,1,1,2,2,4,1,1,1,3,2,5,5,5,3,1,4,1,6,6,6,6,1,4,1,1,3,2,4,4,1,4,1,2,4,4,4,2,5,5,3,
              3,5,3,5,3,1,4,1,1,1,1,3,3,3,2,5,5,3,1,1,1,1,1,4,1,1,3,3,1,1,4,1,3,5,5,5,3,5,5,3,4,4,1,4,1,3,1,1,1,1,
              3,3,3,5,3,1,1,1,1,1,3,3,5,3,5,5,2,5,3,2,3,2,2,3,2,5,3,3,5,5,5,2,4,4,1,1,6,1,2,5,3,4,4,1,1,4,3,5,3,3,
              3,5,3,5,3,5,3,5,5,5,2,5,3,2,5,3,3,5,3,1,1,1,1,1,3,5,3,5,2,3,2,5,5,2,4,4,4,3,4,4,4,3,3,5,3,5,3,5,3,3,
              5,3,5,5,3,3,5,5,5,3,2,5,3,5,5,2,1,1,1,4,1,1,1,3,3,5,3,1,1,4,4,1,1,1,4,4,3,4,4,4,3,2,2,1,1,1,1,2,5,3,
              4,1,1,1,1,3,5,3,5,3,5,5,2,3,3,5,3,1,1,4,4,4,2,5,2,5,3,3,2,4,1,1,4,1,3,5,5,3,2,3,5,5,3,2,3,3,3,5,5,3,
              3,5,5,5,2,5,5,3,3,5,5,3,5,3,5,5,3,3,5,3,5,3,5,5,5,3,3,5,3,5,3,1,1,1,1,4,2,3,3,5,2,2,5,2,1,1,1,1,1,1,
              2,2,1,1,1,4,1,3,3,5,3,5,5,3,3,3,5,2,5,2,5,5,5,2,3,3,5,5,3,5,3,5,3,3,3,4,4,4,2,5,5,3,5,3,3,5,3,3,5,3,
              5,5,3,4,1,4,1,3,5,3,5,3,3,5,5,2,5,3,5,5,5,2,2,4,1,1,1,1,4,1,1,3,5,5,5,2,3,5,2,3,2,3,5,2,5,3,5,5,5,2,
              5,2,5,3,3,5,5,2,5,2,5,3,1,1,1,1,3,5,5,5,2,1,4,4,1,3,3,5,3,1,1,1,1,3,3,3,3,3,5,3,5,5,3,3,3,4,4,4,3,3,
              2,4,1,1,1,1,1,1,4,3,5,2,3,5,3,5,3,2,3,5,3,5,3,5,5,3,1,4,1,1,1,2,3,1,1,1,1,1,1,1,3,3,5,5,5,3,1,1,1,4,
              3,5,2,1,1,1,4,3,3,2,5,3,3,3,5,3,5,3,5,3,5,3,5,2,5,3,3,5,5,5,3,5,3,2,4,4,4,3,2,5,3,1,1,1,1,1,1,2,3,5,
              5,2,3,5,3,5,3,3,4,1,1,1,4,3,3,1,1,1,1,3,5,3,5,3,3,3,4,4,1,1,3,5,3,2,3,5,5,2,5,3,3,3,5,5,2,5,5,3,3,3,
              5,3,5,5,5,3,2,3,5,3,3,3,5,3,3,3,5,3,5,3,3,3,5,5,5,3,5,3,3,3,1,1,6,1,3,5,5,5,3,3,2,3,5,3,5,3,5,5,5,3,
              5,3,2,2,5,5,3,3,3,1,1,1,1,1,1,3,3,2,3,5,5,5,3,3,5,2,5,2,5,3,3,5,3,3,3,5,5,3,5,2,3,5,3,3,3,5,3,3,3,5,
              3,3,5,3,2,3,3,2,1,4,1,1,4,3,3,3,5,5,5,2,3,5,3,2,3,3,5,5,2,2,5,3,3,3,3,3,3,2,2,2,5,3,2,3,3,3,3,1,1,1,
              4,3,3,1,1,1,1,3,2,3,3,5,3,3,2,3,3,3,3,5,3,3,2,2,2,5,3,5,3,2,3,2,5,3,5,2,3,3,5,5,5,3,3,1,1,1,1,1,2,5,
              3,5,5,3,5,3,3,5,5,3,3,5,5,5,2,3,2,3,3,3,3,3,5,3,5,3,2,5,3,1,1,1,1,3,2,5,3,5,5,3,3,3,5,2,5,5,3,5,3,3,
              3,5,5,5,3,5,5,3,5,2,3,3,2,5,3,5,3,3,3,3,3,3,3,5,5,3,3,3,3,5,3,3,5,3,5,5,3,3,3,5,5,5,3,5,5,2,3,5,5,3,
              5,5,3,1,1,1,1,3,5,5,2,5,3,5,5,3,3,3,5,3,3,1,1,1,1,1,3,5,3,3,5,3,3,2,2,3,5,5,5,3,5,3,1,4,1,1,3,2,3,5,
              3,3,3,3,5,5,5,3,5,3,5,3,3,2,2,3,2,3,3,5,3,5,5,3,5,5,5,3,2,3,5,2,2,3,3,3,2,3,5,3,3,5,3,3,3,3,3,3,5,2,
              2,3,5,3,3,5,3,2,3,3,3,3,5,3,3,3,5,2,5,5,5,3,3,5,5,3,3,2,5,3,5,3,3,5,3,5,3,5,5,3,5,5,3,5,5,2,3,3,3,3,
              5,3,3,2,2,3,5,5,2,3,3,5,3,3,4,1,1,4,1,3,5,3,5,5,3,3,5,2,3,5,2,5,5,5,3,3,3,5,3,5,3,3,2,2,5,2,2,5,3,3,
              5,5,5,3,3,3,3,5,5,3,3,1,1,1,1,3,5,5,2,3,5,5,3,5,5,3,5,3,3,4,1,1,4,3,5,3,5,5,3,5,3,2,5,3,1,1,1,1,1,2,
              3,3,3,3,5,3,5,5,3,3,5,3,3,5,5,3,2,3,5,3,5,3,5,2,5,3,5,5,3,5,3,5,5,3,3,5,2,4,1,1,1,1,1,4,3,5,3,3,3,3,
              4,4,4,3,3,3,3,5,5,3,5,3,5,3,3,3,3,1,1,1,4,3,5,3,1,1,1,4,3,3,3,5,3,5,2,5,5,3,5,3,3,5,5,3,3,5,5,3,5,5,
              3,3,5,3,5,5,5,3,3,3,5,3,5,2,3,3,3,1,1,1,1,2,5,3,3,5,5,3,2,5,5,3,3,3,3,3,5,5,3,3,2,5,3,5,3,4,6,1,1,1,
              1,1,3,3,5,5,3,5,5,3,5,2,5,3,5,5,5,3,2,3,5,3,2,5,3,1,1,1,4,1,6,1,2,5,3,2,5,3,5,5,5,3,5,5,3,5,3,3,3,3,
              3,5,5,2,5,5,3,3,3,2,3,3,1,1,4,1,3,1,1,1,1,1,3,5,5,2,3,3,5,3,3,5,5,3,2,5,3,5,3,3,3,5,3,3,5,2,3,3,5,5,
              3,3,2,3,3,3,3,3,2,5,5,3,5,5,5,3,3,3,5,3,5,2,5,5,5,3,3,5,3,3,5,5,5,3,5,5,5,3,3,2,3,3,3,3,3,3,3,3,5,5,
              2,3,3,3,3,2,3,3,5,2,3,5,3,3,2,3,3,5,3,1,1,1,1,3,2,5,3,3,4,1,1,1,2,1,1,1,1,1,2,5,2,4,4,1,4,3,3,5,5,3,
              5,5,3,3,5,3,5,5,2,5,2,1,1,4,4,3,5,5,3,5,5,2,5,5,3,3,5,5,3,3,2,2,3,5,2,3,5,3,3,5,5,5,3,5,5,3,3,3,3,3,
              3,5,5,5,3,1,1,1,1,1,2,3,4,1,1,1,1,6,4,1,3,3,5,3,3,2,2,2,3,2,3,5,5,3,5,5,5,3,5,3,3,5,2,5,5,3,1,1,1,1,
              3,3,5,5,3,5,3,3,3,5,5,3,5,3,5,2,5,2,3,3,5,3,1,1,1,1,1,3,5,5,3,5,3,4,1,6,1,6,4,2,3,5,2,2,5,5,2,5,3,3,
              3,2,5,3,3,5,3,3,3,3,5,5,3,5,5,3,3,5,3,5,3,5,3,5,3,3,5,3,5,3,4,1,4,1,3,5,5,3,1,4,1,1,3,3,3,5,2,5,5,3,
              5,3,2,3,3,5,3,2,3,3,2,2,5,3,4,1,1,1,3,3,3,3,3,2,3,2,1,1,6,1,3,3,3,3,5,3,5,3,5,3,2,3,2,5,5,5,2,3,5,3,
              3,3,5,5,3,5,5,3,5,5,2,5,3,1,1,1,1,3,5,2,5,5,2,3,5,3,5,5,3,5,3,5,5,3,5,3,3,2,2,3,3,5,5,3,3,3,5,5,2,3,
              2,5,5,3,5,3,5,3,5,5,5,3,3,2,5,3,1,1,1,4,1,4,3,2,1,4,6,6,1,3,3,3,5,2,5,3,3,1,1,1,1,2,5,5,3,3,5,2,3,5,
              5,5,3,3,1,4,6,1,3,5,5,3,5,5,2,1,1,1,1,4,2,5,5,3,2,3,5,5,3,5,3,5,3,2,3,3,3,3,3,3,3,5,2,5,5,2,3,3,3,3,
              5,3,3,3,3,3,2,3,5,3,3,3,5,3,3,5,3,3,3,2,4,4,4,3,2,3,3,2,5,3,5,3,2,5,3,2,5,3,5,3,5,3,1,1,1,1,3,1,4,1,
              1,3,2,3,5,5,5,3,5,2,3,3,3,5,3,5,3,5,3,1,1,1,4,3,3,5,3,3,5,3,4,4,4,3,5,5,3,5,5,5,3,3,5,2,3,3,3,3,3,5,
              2,2,1,6,1,1,4,3,5,3,5,5,2,3,3,6,1,1,6,2,3,5,3,3,3,3,5,3,3,3,2,1,4,1,6,3,5,5,3,5,3,3,5,5,3,3,3,5,5,3,
              5,3,3,5,5,3,5,2,3,5,5,5,3,3,2,5,5,3,3,2,5,3,5,3,2,3,5,5,5,3,5,3,1,4,4,1,4,1,4,3,3,2,3,5,5,3,5,3,5,5,
              5,3,5,3,3,4,1,1,1,1,3,3,5,2,1,1,6,1,2,5,5,5,2,5,3,5,3,4,4,4,2,5,5,2,3,3,3,5,5,5,3,5,3,3,1,4,1,1,6,1,
              3,3,2,5,5,5,3,3,3,3,3,3,5,5,3,2,3,5,3,3,2,2,5,5,5,2,3,3,5,5,5,2,5,3,5,3,2,5,5,2,5,3,5,5,5,3,5,2,5,2,
              5,2,3,1,6,1,1,4,1,1,3,3,5,3,5,5,3,1,1,1,1,1,3,3,5,2,3,3,2,1,1,1,1,1,1,1,4,3,3,3,3,5,5,3,3,3,3,5,5,3,
              3,3,5,3,3,2,3,2,3,2,5,2,3,3,1,1,1,1,1,1,1,3,3,5,3,1,1,1,1,1,4,1,4,1,2,5,5,3,3,5,5,5,3,5,5,3,5,5,2,3,
              5,3,3,5,3,3,5,5,3,2,2,3,2,5,5,2,5,2,5,5,5,3,5,5,3,2,5,3,5,3,3,1,1,4,1,3,1,1,4,4,2,2,5,5,5,3,3,5,5,5,
              2,5,3,3,2,3,3,4,1,1,1,1,1,1,1,3,3,2,3,5,5,5,2,5,3,3,3,3,3,3,5,3,2,1,1,6,1,1,3,3,1,4,1,1,1,4,1,1,1,2,
              5,3,5,5,3,5,3,3,5,5,2,3,5,2,5,3,2,5,2,5,5,5,2,3,3,3,2,5,5,2,3,1,1,1,1,2,5,3,3,2,5,3,5,5,2,2,1,1,1,1,
              3,5,3,5,3,5,2,3,5,5,2,5,5,3,3,4,1,4,4,2,5,3,5,2,2,3,5,3,4,4,4,2,1,1,1,1,1,3,3,3,5,5,3,5,3,5,5,2,5,3,
              5,5,3,3,2,5,3,3,5,3,1,1,1,1,3,6,1,4,1,3,5,5,3,5,5,5,3,3,2,5,5,2,5,5,3,5,3,3,3,3,3,2,3,3,3,2,3,3,3,3,
              4,4,4,3,3,5,5,3,5,3,5,5,3,5,5,5,3,4,4,4,3,2,5,3,2,3,3,5,3,3,5,5,3,3,2,5,3,2,3,3,5,5,3,5,5,3,3,2,5,3,
              3,3,3,3,3,5,5,3,3,5,2,5,2,3,5,5,3,3,2,3,5,2,3,3,5,3,2,2,5,3,5,3,3,5,3,5,3,5,3,5,3,2,3,3,2,3,3,5,5,2,
              2,2,5,3,5,5,3,2,5,2,3,5,3,2,3,5,5,3,2,5,3,5,3,5,3,5,3,2,3,3,5,3,3,3,5,5,5,3,3,5,5,3,3,2,5,5,3,1,1,1,
              1,1,4,1,1,3,1,1,1,1,2,5,2,5,2,5,5,3,3,3,3,5,3,2,2,2,1,1,1,1,3,1,4,1,1,1,1,1,1,1,1,3,5,3,2,3,2,3,1,1,
              1,1,1,1,1,1,1,1,1,3,2,1,1,4,1,3,5,5,2,4,4,4,2,5,3,1,1,1,1,1,3,5,3,2,4,4,6,1,1,1,1,3,3,1,1,4,1,3,5,5,
              3,1,1,1,1,3,1,1,6,4,1,2,5,5,3,5,3,5,5,2,3,3,1,1,4,1,2,3,5,5,3,5,3,5,5,5,2,3,3,5,3,2,5,3,3,3,3,3,3,2,
              5,3,5,5,3,5,3,3,3,3,3,5,3,2,1,4,1,1,1,3,5,3,5,3,5,3,3,3,3,5,5,3,2,3,3,5,2,3,1,1,1,1,3,5,5,3,3,3,3,3,
              5,5,2,5,2,5,3,5,3,3,3,3,3,3,3,3,3,5,3,2,5,5,2,3,2,3,3,3,3,5,3,5,3,5,5,3,5,5,3,2,5,5,2,3,5,3,3,3,5,5,
              5,3,3,5,3,3,3,5,5,3,5,3,3,3,2,3,5,3,5,5,2,5,5,3,3,3,3,5,3,3,3,3,5,5,3,2,3,5,5,3,5,3,3,3,6,1,1,4,3,3,
              5,2,3,3,4,1,1,1,1,2,5,3,2,5,3,3,3,5,5,3,3,5,2,3,3,3,3,5,3,5,3,5,5,3,5,5,5,3,3,5,3,3,5,3,5,3,3,2,5,3,
              5,3,3,5,3,5,3,3,5,3,5,5,3,3,5,2,3,3,1,1,1,1,1,3,5,5,2,2,5,3,3,3,3,3,3,5,5,3,3,3,4,4,4,3,3,5,5,5,2,3,
              5,2,5,3,5,2,2,3,5,3,3,5,5,3,5,5,2,3,3,5,3,3,3,5,2,3,3,3,5,3,3,3,5,3,1,1,1,1,3,5,2,3,3,3,2,5,3,2,5,3,
              5,3,3,2,3,3,3,5,3,3,2,2,3,1,1,6,1,3,5,5,2,2,5,5,2,5,3,5,3,5,5,3,3,5,2,5,5,3,3,3,3,5,3,2,2,3,3,2,5,3,
              5,3,5,5,5,3,3,5,3,3,3,3,2,3,5,5,3,3,5,2,3,3,3,5,3,3,3,5,5,3,5,2,5,2,3,5,5,3,3,2,6,1,1,1,2,2,3,3,3,2,
              3,3,5,3,3,5,3,2,3,5,3,5,5,3,3,5,5,3,5,5,2,5,5,2,5,3,5,5,5,3,5,3,3,5,3,5,5,3,3,5,3,3,5,3,5,5,5,3,2,3,
              3,3,3,3,3,2,5,3,3,5,5,5,3,3,3,2,5,3,2,3,3,3,2,3,3,5,5,3,5,3,5,3,2,5,2,5,5,2,3,5,2,3,5,2,5,5,3,3,3,5,
              3,3,3,5,5,3,3,2,3,3,3,5,5,3,2,3,5,5,3,1,1,1,1,2,5,5,3,1,1,1,1,1,3,3,3,5,5,3,3,5,3,3,3,3,1,1,1,1,3,2,
              3,2,3,3,5,3,5,3,2,2,5,3,3,5,3,3,5,3,3,1,1,1,1,2,3,5,2,2,5,3,3,5,5,3,5,5,3,2,5,5,5,3,3,5,3,3,3,5,5,5,
              3,3,3,3,5,3,5,3,5,3,1,1,1,1,6,3,5,5,5,3,5,5,5,2,3,3,5,2,5,5,5,3,5,2,3,2,3,3,5,5,3,3,5,5,3,2,5,3,2,3,
              3,2,5,3,5,5,5,3,3,3,2,3,5,5,3,3,3,3,5,5,3,5,5,2,2,5,3,5,5,3,5,3,3,3,5,3,5,5,5,3,3,2,2,3,5,3,2,5,3,5,
              2,5,5,3,3,5,3,3,5,3,2,5,3,3,2,5,5,2,3,3,2,3,5,3,3,3,3,5,5,5,3,3,5,2,5,5,3,2,3,5,3,5,3,3,2,5,3,5,3,3,
              5,5,3,3,3,5,3,3,5,3,3,3,3,3,3,5,2,3,5,5,2,5,3,3,3,2,5,3,3,5,3,3,2,3,3,5,3,2,3,3,5,5,2,3,3,3,2,5,3,3,
              3,3,5,3,5,5,3,5,2,3,2,5,5,3,3,3,5,2,3,5,5,3,5,3,5,3,5,3,3,5,5,3,3,3,3,5,3,2,3,2,5,3,5,5,2,5,3,2,2,3,
              5,3,3,5,5,3,3,3,5,5,3,5,3,2,1,1,1,1,1,2,3,3,3,3,3,3,5,3,3,3,3,3,2,3,5,3,3,5,3,5,3,3,3,2,5,3,3,2,3,5,
              5,5,3,3,3,5,2,3,5,5,3,3,5,3,5,5,5,2,3,5,3,5,3,3,5,2,5,3,3,5,3,3,2,3,3,5,3,5,5,3,2,3,3,5,5,3,3,3,2,2,
              5,3,5,3,5,3,5,3,1,1,1,1,3,5,2,2,5,3,5,3,3,2,5,3,3,3,3,3,3,2,2,2,2,5,5,3,3,3,3,2,3,1,1,1,1,2,5,5,3,5,
              5,2,3,3,5,3,5,3,3,5,3,5,3,2,3,5,5,5,2,3,3,4,4,4,3,1,1,1,1,3,4,1,1,1,2,5,3,5,3,5,5,5,2,5,2,3,3,5,5,3,
              5,3,5,5,2,5,3,3,4,4,4,3,2,2,3,2,3,3,3,5,5,3,5,3,3,5,5,3,3,5,2,3,5,2,1,1,1,1,3,3,3,5,5,2,5,3,5,3,3,3,
              5,5,5,3,5,5,3,3,3,3,5,3,5,5,3,5,5,3,3,5,5,3,5,5,2,3,1,1,1,1,3,5,3,5,2,3,2,5,2,2,3,3,6,1,6,1,4,3,3,3,
              5,3,5,3,5,3,2,3,5,3,3,5,3,5,3,3,5,5,3,3,3,3,5,3,5,3,3,3,3,3,5,3,5,3,5,3,4,4,4,3,3,3,3,5,3,3,3,3,3,3,
              3,2,5,3,5,5,2,3,5,5,3,3,5,5,3,3,5,3,3,5,3,3,3,3,3,2,3,5,3,3,2,5,5,3,5,2,3,5,5,5,3,5,3,3,5,5,2,3,5,5,
              2,1,1,1,1,1,1,3,3,5,5,3,3,4,4,4,3,5,3,5,5,2,5,3,3,2,5,3,2,3,5,3,3,2,3,2,3,3,3,2,2,5,3,3,5,5,5,3,5,5,
              5,2,5,2,5,2,5,2,3,5,2,5,5,2,3,2,2,5,3,1,1,1,1,3,3,5,3,5,5,3,5,3,3,3,3,3,3,3,3,3,5,3,3,3,5,5,3,3,3,5,
              5,2,3,3,3,2,3,3,5,5,3,2,3,1,4,1,4,3,5,5,3,5,5,5,3,5,5,2,2,2,3,3,3,5,2,5,3,2,3,5,5,3,3,5,3,3,3,3,5,5,
              3,3,2,5,3,5,2,2,3,5,3,5,3,5,3,3,3,5,3,3,3,3,3,3,2,3,5,3,3,5,2,5,3,3,3,2,3,1,1,1,1,3,2,2,3,3,3,2,5,2,
              5,3,3,5,3,1,1,1,1,3,5,3,3,2,2,5,3,5,3,3,3,3,3,5,5,3,3,5,3,3,3,3,2,5,3,5,2,2,2,2,3,3,5,2,5,3,5,3,3,5,
              3,3,2,5,2,3,3,5,3,5,5,2,3,3,5,3,5,3,3,3,3,3,3,5,5,3,2,2,2,2,2,1,4,1,1,1,1,1,2,3,5,3,3,5,3,3,3,3,3,5,
              5,5,3,5,3,3,3,5,5,3,3,2,5,5,3,5,5,3,3,3,3,5,3,5,3,5,3,5,3,5,5,3,2,5,2,5,5,3,5,5,2,3,2,5,5,3,3,2,2,5,
              3,5,3,3,5,3,5,3,2,3,3,3,3,1,1,1,4,3,5,5,3,5,5,2,2,3,3,5,5,2,2,3,5,5,3,3,5,2,5,5,3,3,3,5,3,3,3,3,3,3,
              3,5,3,3,3,3,3,5,3,3,5,2,3,5,2,3,5,5,5,3,5,5,5,3,5,3,3,5,5,5,2,3,3,2,5,3,5,3,3,5,5,3,3,3,3,3,3,2,3,5,
              3,5,2,5,5,3,5,3,5,3,3,5,2,5,5,3,3,3,3,5,3,3,3,3,3,2,2,5,5,3,3,5,5,3,3,1,1,1,1,2,3,5,3,3,5,3,5,5,2,3,
              5,5,3,3,5,3,3,3,3,3,3,3,5,3,3,3,3,5,5,5,3,3,3,5,3,3,5,3,5,2,3,3,5,5,3,3,5,2,3,3,2,3,3,3,3,5,5,3,2,3,
              3,3,3,5,3,3,2,5,5,3,5,3,5,3,1,1,1,1,2,3,3,2,3,2,5,2,5,2,5,2,5,2,3,2,3,2,3,2,3,3,5,3,5,2,3,3,3,3,5,3,
              5,3,5,3,3,3,5,5,3,2,5,3,5,3,3,3,5,2,5,3,3,5,3,2,4,1,1,1,1,1,1,1,1,1,4,3,5,5,3,5,5,5,2,2,2,5,5,3,3,3,
              3,3,3,3,3,5,5,3,3,2,3,5,2,5,5,3,2,3,5,5,5,3,1,1,1,1,1,1,1,2,5,5,5,3,5,3,1,4,1,1,1,1,2,3,3,5,5,3,3,2,
              5,5,3,3,3,2,3,2,3,5,3,3,2,3,2,3,3,5,5,5,3,5,5,5,3,2,5,5,5,2,3,3,3,3,3,1,1,1,4,2,3,5,3,2,5,3,3,3,2,3,
              3,3,5,3,3,3,3,5,5,3,3,3,3,3,2,2,5,3,3,3,5,2,3,3,2,3,5,5,2,5,5,3,3,5,3,3,5,5,3,3,3,3,2,5,3,5,5,2,5,3,
              3,3,5,5,2,2,2,3,3,3,5,3,3,3,2,5,2,5,5,3,5,5,3,2,5,3,5,3,3,2,3,3,5,3,5,3,2,3,3,3,3,3,

              Вторичная структура (Пикотех-2017) весит около 6 мегабайт в стандарте PNG: https://cloud.mail.ru/public/KKjH/goMgmMGAn

              На яндекс-фотки не грузится. Но самый интересный фрагмент удалось вырезать в программе Paint:



              Сиреневым цветом отмечен виток необычной метиониновой спирали. В отличие от альфа-спирали у неё более длинный шаг. Метиониновая спираль отличается от обычной альфа-спирали примерно как резьба с более крупным шагом от резьбы с менее крупным шагом:


              Шаг метиониновой спирали примерно на 25% крупнее шага обычной альфа-спирали. При этом на один виток приходится тоже 3.6...3.7 аминокислотных остатка Met.

               



              Ещё один интересный участок этого белка 3916...4164. Он содержит все типы композиционных кодов: 1,2,3,4, но ... не содержит ни одного витка спирали! Интересно оценить вероятность случайной комбинации композиционных кодов такого типа. Напомню, что спираль возникает при трёхкратном (или более) повторении кодов 1, 4 или их комбинации. При этом третий код должен быть "4", либо спиральных кодов (1,4), идущих подряд, должно быть больше 3.

               

               




              Белковая молекула кончается витком полилизиновой пи-спирали, похожей на винт Архимеда.

               

               

               


              Уточнение 2D структур некоторых G-белков, взятых из базы NCBI, методом Пикотех

              2017.12.05 17:53:30



                2D диаграммы Пикотех белковых структур, исследованных методом РСА, версия 2017 года 6var.




                СТРУКТУРА ДИАГРАММЫ ПИКОТЕХ 


                 

                СОКРАЩЁННАЯ ДИАГРАММА
                Красный - альфа-спираль.
                Оранжевый - 310-спираль.
                Розовый - одиночный код альфа/310 спиралей.
                Голубой - пи-спираль.
                Зеленый - бета-спираль.
                Сиреневый - метиониновая спираль. У неё более крупный шаг "резьбы", чем у обычной альфа-спирали.
                Черный в сокращённом представлении и белый в развернутом означают либо неизвестный код, либо конец трансляции.
                Циклическое повторение цветов - программная спираль.

                ПОЛНАЯ ДИАГРАММА
                Содержание столбцов
                1 - порядковый номер аминокислотного остатка в белковой молекуле
                2 - триплетный код
                3 - однобуквенный код аминокислотного остатка
                4 - трёхбуквенное обозначение аминокислотного остатка
                5 - упрощённый композиционный код
                6 - графическая интерпретация упрощенного композиционного кода
                7 - композиционный код
                8 - графическая интерпретация композиционного кода
                9 - нота, которая звучит при установке данной аминокислоты в растущую белковую цепь
                10 - графическое изображение ноты (или ударного инструмента)
                Для новой версии Пикотех 2018 разработан Композиционный код 7var
                https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae92_83cc91e_orig.jpg

                Программные спирали - повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).


                1111111111111111111 - прямая альфа-спираль
                4444444444444444444 - прямая 310-спираль
                3333333333333333333 - прямая пи-спираль
                2222222222222222222 - прямая бета-спираль
                232323 - программная 23-спираль
                141414 - программная 14-спираль











                1.
                https://www.ncbi.nlm.nih.gov/Structure/ … p;uid=5TUD

                Structural insights into the extracellular recognition of the human serotonin 2B receptor by an antibody

                Ishchenko A, Wacker D, Kapoor M, Zhang A, Han GW, Basu S, Patel N, Messerschmidt M, Weierstall U, Liu W, Katritch V, Roth BL, Stevens RC, Cherezov V

                https://img-fotki.yandex.ru/get/880375/249950893.0/0_16a3b7_7315a46a_orig.png

                https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

                >ENA|CAA54513|CAA54513.1 Homo sapiens (human) 5-HT2B serotonin receptor 
                ATGGCTCTCTCTTACAGAGTGTCTGAACTTCAAAGCACAATTCCTGAGCACATTTTGCAG
                AGCACCTTTGTTCACGTTATCTCTTCTAACTGGTCTGGATTACAGACAGAATCAATACCA
                GAGGAAATGAAACAGATTGTTGAGGAACAGGGAAATAAACTGCACTGGGCAGCTCTTCTG
                ATACTCATGGTGATAATACCCACAATTGGTGGAAATACCCTTGTTATTCTGGCTGTTTCA
                CTGGAGAAGAAGCTGCAGTATGCTACTAATTACTTTCTAATGTCCTTGGCGGTGGCTGAT
                TTGCTGGTTGGATTGTTTGTGATGCCAATTGCCCTCTTGACAATAATGTTTGAGGCTATG
                TGGCCCCTCCCACTTGTTCTATGTCCTGCCTGGTTATTTCTTGACGTTCTCTTTTCAACC
                GCATCCATCATGCATCTCTGTGCCATTTCAGTGGATCGTTACATAGCCATCAAAAAGCCA
                ATCCAGGCCAATCAATATAACTCACGGGCTACAGCATTCATCAAGATTACAGTGGTGTGG
                TTAATTTCAATAGGCATTGCCATTCCAGTCCCTATTAAAGGGATAGAGACTGATGTGGAC
                AACCCAAACAATATCACTTGTGTGCTGACAAAGGAACGTTTTGGCGATTTCATGCTCTTT
                GGCTCACTGGCTGCCTTCTTCACACCTCTTGCAATTATGATTGTCACCTACTTTCTCACT
                ATCCATGCTTTACAGAAGAAGGCTTACTTAGTCAAAAACAAGCCACCTCAACGCCTAACA
                TGGTTGACTGTGTCTACAGTTTTCCAAAGGGATGAAACACCTTGCTCGTCACCGGAAAAG
                GTGGCAATGCTGGATGGTTCTCGAAAGGACAAGGCTCTGCCCAACTCAGGTGATGAAACA
                CTTATGCGAAGAACATCCACAATTGGGAAAAAGTCAGTGCAGACCATTTCCAACGAACAG
                AGAGCCTCAAAGGTCCTAGGGATTGTGTTTTTCCTCTTTTTGCTTATGTGGTGTCCCTTC
                TTTATTACAAATATAACTTTAGTTTTATGTGATTCCTGTAACCAAACTACTCTCCAAATG
                CTCCTGGAGATATTTGTGTGGATAGGCTATGTTTCCTCAGGAGTGAATCCTTTGGTCTAC
                ACCCTCTTCAATAAGACATTTCGGGATGCATTTGGCCGATATATCACCTGCAATTACCGG
                GCCACAAAGTCAGTAAAAACTCTCAGAAAACGCTCCAGTAAGATCTACTTCCGGAATCCA
                ATGGCAGAGAACTCTAAGTTTTTCAAGAAACATGGAATTCGAAATGGGATTAACCCTGCC
                ATGTACCAGAGTCCAATGAGGCTCCGAAGTTCAACCATTCAGTCTTCATCAATCATTCTA
                CTAGATACGCTTCTCCTCACTGAAAATGAAGGTGACAAAACTGAAGAGCAAGTTAGTTAT
                GTATAG

                http://nanoworld.org.ru/post/96477/#p96477
                Программа Пикотех показывает следующую детализированную структуру.
                Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
                431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.

                https://img-fotki.yandex.ru/get/893753/249950893.1/0_16aff1_b0049741_orig.png

                https://img-fotki.yandex.ru/get/510105/249950893.1/0_16aff0_89b162aa_orig.png









                2. 
                https://www.ncbi.nlm.nih.gov/Structure/pdb/5V56

                Crystal structure of a multi-domain human smoothened receptor in complex with a super stabilizing ligand

                Zhang X, Zhao F, Wu Y, Yang J, Han GW, Zhao S, Ishchenko A, Ye L, Lin X, Ding K, Dharmarajan V, Griffin PR, Gati C, Nelson G, Hunter MS, Hanson MA, Cherezov V, Stevens RC, Tan W, Tao H, Xu F

                https://img-fotki.yandex.ru/get/896238/249950893.1/0_16afce_af6cf2b8_orig.png

                http://www.rcsb.org/pdb/explore/explore … ureId=5V56
                https://www.ebi.ac.uk/ena/data/view/AAA … play=fasta

                >ENA|AAA23367|AAA23367.1 Desulfovibrio vulgaris hypothetical protein 
                ATGCCCAAAGCCCTCATCGTCTACGGTTCCACCACAGGCAACACGGAATACACCGCCGAA
                ACCATCGCACGTGAACTTGCCGATGCAGGGTACGAAGTCGATAGCCGGGACGCGGCCTCT
                GTCGAGGCTGGCGGTCTCTTCGAAGGCTTCGACCTCGTCCTTCTCGGATGCTCGACGTGG
                GGTGACGACTCCATCGAACTGCAGGACGACTTCATTCCCCTTTTCGACTCCCTCGAAGAG
                ACGGGGGCGCAGGGCCGCAAGGTGGCCTGCTTCGGCTGCGGCGACAGTTCCTACGAGTAC
                TTCTGCGGGGCTGTCGACGCCATCGAAGAGAAGCTCAAGAACCTCGGTGCCGAAATCGTT
                CAGGACGGTCTTCGCATCGATGGCGACCCCCGCGCCGCCCGGGACGACATCGTCGGCTGG
                GCGCATGACGTGAGGGGCGCCATCTAG

                http://nanoworld.org.ru/post/96494/#p96494
                Результаты программы Пикотех

                4-8 - альфа-спираль
                49-53 - альфа-спираль
                57-60 - альфа-спираль
                62-65 - альфа-спираль
                67-71 - альфа-спираль
                75-78 - альфа-спираль
                80-95 - альфа-спираль
                97-103 - альфа-спираль
                105-108 - альфа-спираль
                110-115 - альфа-спираль
                115-121 - программная 35-спираль
                120-127 - программная 3355-спираль
                128-141 - альфа-спираль
                143-148 - альфа-спираль

                https://img-fotki.yandex.ru/get/877700/249950893.1/0_16afc9_75560fe6_orig.png

                https://img-fotki.yandex.ru/get/477847/249950893.1/0_16afeb_a12b3edb_orig.png










                3.
                https://www.ncbi.nlm.nih.gov/Structure/pdb/5W0P

                Identification of Phosphorylation Codes for Arrestin Recruitment by G Protein-Coupled Receptors

                Zhou XE, He Y, de Waal PW, Gao X, Kang Y, Van Eps N, Yin Y, Pal K, Goswami D, White TA, Barty A, Latorraca NR, Chapman HN, Hubbell WL, Dror RO, Stevens RC, Cherezov V, Gurevich VV, Griffin PR, Ernst OP, Melcher K, Xu HE

                https://img-fotki.yandex.ru/get/476913/249950893.0/0_16a3b9_61f34840_orig.png

                https://www.ebi.ac.uk/ena/data/view/CAD … play=fasta

                >ENA|CAD97623|CAD97623.1 Homo sapiens (human) hypothetical protein 
                ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTA
                CGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTG
                GCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTAC
                GTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCC
                GTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCAT
                GGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGC
                GGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGT
                AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACC
                TGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCC
                GAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAAC
                GAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTT
                TTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCA
                GCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCT
                TTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGC
                TCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATC
                TACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACC
                ATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACG
                GAGACGAGCCAGGTGGCCCCGGCCTAA

                http://nanoworld.org.ru/post/96490/#p96490
                Программа Пикотех показывает

                8-14 - альфа-спираль.
                21-26 - альфа-спираль.
                28-31 - альфа-спираль.
                35-44 - альфа-спираль.
                46-70 - 310-альфа-спираль.
                72-78 - альфа-спираль.
                83-87 - альфа-спираль.
                90-97 - альфа-спираль.
                102-107 - альфа-спираль.
                112-115 - альфа-спираль.
                117-120 - альфа-спираль.
                124-139 - альфа-спираль.
                141-151 - альфа-спираль.
                153-156 - альфа-спираль.
                158-168 - альфа-спираль.
                172-186 - альфа-спираль.
                189-201 - альфа-спираль.
                204-216 - альфа-спираль.
                215-225 - программная 355-спираль.
                224-233 - альфа-спираль.
                235-239 - альфа-спираль.
                238-248 - программная 255-спираль.
                247-259 - альфа-спираль.
                261-271 - альфа-спираль.
                273-283 - альфа-спираль.
                285-290 - альфа-спираль.
                295-302 - альфа-спираль.
                307-326 - альфа-спираль.
                336-348 - альфа-спираль.

                https://img-fotki.yandex.ru/get/516062/249950893.1/0_16afec_886d280e_orig.png

                https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcc_519f9d05_orig.png













                4.
                https://www.ncbi.nlm.nih.gov/Structure/pdb/5XEZ

                Structure of the full-length glucagon class B G-protein-coupled receptor

                Zhang H, Qiao A, Yang D, Yang L, Dai A, de Graaf C, Reedtz-Runge S, Dharmarajan V, Zhang H, Han GW, Grant TD, Sierra RG, Weierstall U, Nelson G, Liu W, Wu Y, Ma L, Cai X, Lin G, Wu X, Geng Z, Dong Y, Song G, Griffin PR, Lau J, Cherezov V, Yang H, Hanson MA, Stevens RC, Zhao Q, Jiang H, Wang MW, Wu B

                https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcd_1b4a76df_orig.png

                http://www.rcsb.org/pdb/explore/explore … ureId=5XEZ
                http://www.uniprot.org/uniprot/P47871
                https://www.ebi.ac.uk/ena/data/view/AAC … play=fasta

                >ENA|AAC52063|AAC52063.1 Homo sapiens (human) glucagon receptor 
                ATGCCCCCCTGCCAGCCACAGCGACCCCTGCTGCTGTTGCTGCTGCTGCTGGCCTGCCAG
                CCACAGGTCCCCTCCGCTCAGGTGATGGACTTCCTGTTTGAGAAGTGGAAGCTCTACGGT
                GACCAGTGTCACCACAACCTGAGCCTGCTGCCCCCTCCCACGGAGCTGGTGTGCAACAGA
                ACCTTCGACAAGTATTCCTGCTGGCCGGACACCCCCGCCAATACCACGGCCAACATCTCC
                TGCCCCTGGTACCTGCCTTGGCACCACAAAGTGCAACACCGCTTCGTGTTCAAGAGATGC
                GGGCCCGACGGTCAGTGGGTGCGTGGACCCCGGGGGCAGCCTTGGCGTGATGCCTCCCAG
                TGCCAGATGGATGGCGAGGAGATTGAGGTCCAGAAGGAGGTGGCCAAGATGTACAGCAGC
                TTCCAGGTGATGTACACAGTGGGCTACAGCCTGTCCCTGGGGGCGCTGCTCCTCGCCTTG
                GCCATCCTGGGGGGCCTCAGCAAGCTGCACTGCACCCGCAATGCCATCCACGCGAATCTG
                TTTGCGTCCTTCGTGCTGAAAGCCAGCTCCGTGCTGGTCATTGATGGGCTGCTCAGGACC
                CGCTACAGCCAGAAAATTGGCGACGACCTCAGTGTCAGCACCTGGCTCAGTGATGGAGCG
                GTGGCTGGCTGCCGTGTGGCCGCGGTGTTCATGCAATATGGCATCGTGGCCAACTACTGC
                TGGCTGCTGGTGGAGGGCCTGTACCTGCACAACCTGCTGGGCCTGGCCACCCTCCCCGAG
                AGGAGCTTCTTCAGCCTCTACCTGGGCATCGGCTGGGGTGCCCCCATGCTGTTCGTCGTC
                CCCTGGGCAGTGGTCAAGTGTCTGTTCGAGAACGTCCAGTGCTGGACCAGCAATGACAAC
                ATGGGCTTCTGGTGGATCCTGCGGTTCCCCGTCTTCCTGGCCATCCTGATCAACTTCTTC
                ATCTTCGTCCGCATCGTTCAGCTGCTCGTGGCCAAGCTGCGGGCACGGCAGATGCACCAC
                ACAGACTACAAGTTCCGGCTGGCCAAGTCCACGCTGACCCTCATCCCTCTGCTGGGCGTC
                CACGAAGTGGTCTTCGCCTTCGTGACGGACGAGCACGCCCAGGGCACCCTGCGCTCCGCC
                AAGCTCTTCTTCGACCTCTTCCTCAGCTCCTTCCAGGGCCTGCTGGTGGCTGTCCTCTAC
                TGCTTCCTCAACAAGGAGGTGCAGTCGGAGCTGCGGCGGCGTTGGCACCGCTGGCGCCTG
                GGCAAAGTGCTATGGGAGGAGCGGAACACCAGCAACCACAGGGCCTCATCTTCGCCCGGC
                CACGGCCCTCCCAGCAAGGAGCTGCAGTTTGGGAGGGGTGGTGGCAGCCAGGATTCATCT
                GCGGAGACCCCCTTGGCTGGTGGCCTCCCTAGATTGGCTGAGAGCCCCTTCTGA

                http://nanoworld.org.ru/post/96505/#p96505
                Программа Пикотех показывает

                147-173 - наиболее протяженный участок альфа-310-спирали. 
                Весь белок представлен преимущественно участками альфа-310-спиралей.

                https://img-fotki.yandex.ru/get/509739/249950893.1/0_16b0a0_f8fd49ff_orig.png

                https://img-fotki.yandex.ru/get/893904/249950893.1/0_16b0a1_6da31b90_orig.png










                5.
                https://www.ncbi.nlm.nih.gov/pubmed/17962520
                https://www.ncbi.nlm.nih.gov/Structure/ … ;uid=60314

                High-resolution crystal structure of an engineered human beta2-adrenergic G protein-coupled receptor.

                Cherezov V1, Rosenbaum DM, Hanson MA, Rasmussen SG, Thian FS, Kobilka TS, Choi HJ, Kuhn P, Weis WI, Kobilka BK, Stevens RC.

                https://img-fotki.yandex.ru/get/893240/249950893.0/0_16a3b1_d636e8c2_orig.png

                https://www.rcsb.org/pdb/explore/explor … ureId=2RH1

                https://img-fotki.yandex.ru/get/6713/249950893.1/0_16afcf_be7ab3f6_orig.png

                http://www.uniprot.org/uniprot/P00720
                https://www.ebi.ac.uk/ena/data/view/CAA28212

                >ENA|CAA28212|CAA28212.1 Enterobacteria phage T4 hypothetical protein 
                ATGAATATATTTGAAATGTTACGTATAGATGAACGTCTTAGACTTAAAATCTATAAAGAC
                ACAGAAGGCTATTACACTATTGGCATCGGTCATTTGCTTACAAAAAGTCCATCACTTAAT
                GCTGCTAAATCTGAATTAGATAAAGCTATTGGGCGTAATTGCAATGGTGTAATTACAAAA
                GATGAGGCTGAAAAACTCTTTAATCAGGATGTTGATGCTGCTGTTCGCGGAATTCTGAGA
                AATGCTAAATTAAAACCGGTTTATGATTCTCTTGATGCGGTTCGTCGCTGTGCATTGATT
                AATATGGTTTTCCAAATGGGAGAAACCGGTGTGGCAGGATTTACTAACTCTTTACGTATG
                CTTCAACAAAAACGCTGGGATGAAGCAGCAGTTAACTTAGCTAAAAGTATATGGTATAAT
                CAAACACCTAATCGCGCAAAACGAGTCATTACAACGTTTAGAACTGGCACTTGGGACGCG
                TATAAAAATCTATAA



                Версия 2016 года -6var

                https://img-fotki.yandex.ru/get/517809/249950893.1/0_16afd8_c591449d_orig.png

                https://img-fotki.yandex.ru/get/768139/249950893.1/0_16afd9_74627b67_orig.png






                Версия 2018 года - 7var

                Темно-синим цветом показаны пи-спирали, бирюзовым - одиночные АО попи-коду.  Белок состоит преимущественно из пи-спиралей.



                Этот пример демонстрирует, что РСА не от личает пи- от  310- спиралей.