Перевести страницу
Узнайте 2D и 3D структуры исследуемых Вами белков с точностью до пикометра


 Ваша заявка должна содержать лишь код нуклеотидной последовательности EMBL интересующего Вас белка, либо мРНК для него.
Мы смоделируем комплекс Вашего белка с лигандами любой природы.
Сроки выполнения заказа - от 1 часа до 7 суток в зависимости от сложности проекта.


Резюме метода





ЭЛЕКТРОН КАК БУБЛИК СО СТОЯЧЕЙ ВОЛНОЙ   

ЭЛЕКТРОН - ЗАКОЛЬЦОВАННЫЙ ФОТОН

ВОЛНОВЫЙ СВОЙСТВА И КОЛЬЦЕВЫЕ СТРУКТУРЫ ЧАСТИЦ МИКРОМИРА







КОЛЬЦЕГРАННОЕ ПРЕДСТАВЛЕНИЕ АТОМОВ


http://nanoworld88.narod.ru/data/493_files/0_80f5c_.gif











МОНОГРАФИЯ  2016 И НЕКОТОРЫЕ ПУБЛИКАЦИИ


В.Соколик, А.Кушелев. Монография 

"Геометрия живого наномира. Пикотехнология белков"  

LAP LAMBERT Academic Publishing  (2016-08-04 )

Купить книгу

Читать фрагменты книги, предисловие рецензентов, послесловие авторов

В.В. Соколик "Никакой дополнительной информации, большей, чем та, что содержится в ДНК, для сворачивания белка не требуется" Матеріали ХІ Укріїнського біохімічного конгресу (06-10 жовтня 2014), The Ukrainian Biochemical Journal, 2014, V. 86, №5 (Supplement 1), P. 37-38.

В. Соколик. СТРУКТУРНЫ ПРЕДПОСЫЛКИКИ АГРЕГАЦИИ БЕТА-АМИЛОИДНОГО ПЕПТИДА

V.Sokolik. ALGORITHM OF PROTEIN STRUCTURAL TEMPLATE DECODING ACCODING TO ITS DETERMINED NUCLEOTIDE SEQUENCE

V. Sokolik. Modeling of the 3D structure of apoliprotezin E3 under its determining nucleotide sequence.

Виктория Соколик, научные труды





Монография посвящена 3D-структуре молекул и полимеров живых систем. Дан анализ современного понимания таких фундаментальных понятий, как физический объём атома, химическая связь, генетический код. На основе статистического анализа экспериментальных данных о структуре белка обосновано кодирование его вторичной структуры и структурного полипептидного шаблона в геноме. Предложена дополненная таблица генетического кода белков и пептидов, которая легла в основу геометрического алгоритма программ декодирования структурного шаблона белка Molecular Constructor и Picotech. Сформулирована гипотеза о перекодировании информации третьего нуклеотида кодона в соответствующий ротамер пептидной связи непосредственно 3D-структурой изоакцепторной тРНК. Математический анализ сопряженности значений углов φ и ψ (карта Рамачандрана) выявил периодичность их изменения, что позволило обосновать механизм посттрансляционного фолдинга белка. Книга рассчитана на специалистов, занимающихся исследованиями в области молекулярной биологии, биоинформатики, биохимии, биофизики







ПРЕАМБУЛА




В настоящее время одним из популярных алгоритмов моделирования пространственной структуры белка, который исходит из его аминокислотной последовательности, является способ построение модели по гомологии на основе общего структурного шаблона. 


Разработан новый способ моделирования структурного шаблона белка по детерминирующей его нуклеотидной последовательности, поскольку информация о топологии вторичной структуры белка и его индивидуальном  структурном шаблоне  содержится непосредственно в гене каждого белка. Эта информация может быть декодирована в соответствии с таблицей генетического кода структурного шаблона белка авторскими программами Пикотех (PT) и Молекулярный конструктор (МС) в виде координатного файла в pdb-формате. 


Важным достоинством метода является то, что можно построить структурный шаблон индивидуально для любого неизвестного белка лишь “прочитав” детерминирующую его нуклеотидную последовательность. Такой шаблон служит единой матрицей для пространственной структуры всех молекул данного белка в ходе посттрансляционного фолдинга in vivo и виртуального фолдинга или докинга in silico.


Модели белковых молекул в Пикотехнологии  предполагают наличие "жестких" кольцеобразных структур в электронных оболочках атомов, соединяющихся в многогранники. Это позволяет нам типологизировать формы участков белковых молекул и точно описать их в трехмерном изображении, с точностью до пикометра.







ФОРМИРОВАНИЕ УГЛОВ БЕЛКОВЫХ СПИРАЛЕЙ


Согласно методу Пикотехнологии, электрон имеет "скелет" в виде кольца диаметром типа 1.7 ангстрема (для внешних оболочек водорода, углерода, азота, кислорода). Кольцевые "скелеты" электронов формируют кольцегранные электронные оболочки и кольцевые механизмы молекул. Модели этих механизмов показывают, как складываются альфа-спираль, 310-спираль, смешанные альфа-310-спирали, пи-спирали и бета-спирали, которые оказались не по 2 остатка на виток.


Поворот на 120 градусов относительно оси симметрии tRNA формирует углы альфа-310-, бета-, пи-спиралей соответственно.








УГЛЫ ПОВОРОТА АМИНОКИСЛОТНЫХ ОСТАТКОВ


Триплеты ДНК кодируют аминокислоты. В упрощённом представлении третья буква триплета управляет углом поворота. Это показывают пикотехнологические 3D модели аминокислотных остатков. Один аминокислотный остаток можно повернуть относительно другого на углы 0, 120 и 240 градусов.  Для описания пространственных структур белковых молекул представлен Композиционный генетический код.

Подробнее 







КОМПОЗИЦИОННЫЙ ГЕНЕТИЧЕСКИЙ КОД







БЕЛКОВЫЕ  СПИРАЛИ


http://img-fotki.yandex.ru/get/6210/126580004.53/0_bcc31_366c6e2c_S.gif http://img-fotki.yandex.ru/get/6304/126580004.53/0_bcc32_4f52ef7b_S.gif http://img-fotki.yandex.ru/get/6302/126580004.52/0_bcc2f_a96d98c5_S.gif http://img-fotki.yandex.ru/get/6307/126580004.52/0_bcc30_b4791ec4_S.gif
Альфа-спираль Бета-спираль Пи-спираль 310-спираль Метиониновая спираль







3D СТРУКТУРЫ АМИНОКИСЛОТНЫХ ОСТАТКОВ


http://img-fotki.yandex.ru/get/58191/137150420.1/0_6a508_a1e8e978_XL.jpg


  






Суставы Pro  и  Met


Pro - это иминокислотный остаток, структура которого гнется не только в плоскости пептидной группы (транспозиционный угол), но и в другой плоскости (пролиновый угол). 


Для точного пространственного моделирования программа, написанная по упрощённому алгоритму подходит только для узкого класса белков типа лизоцима, где нет ни аминокислотных остатков Pro, ни Met.


Три угловых  фрактальных шкалы  показывают композиционный, транспозиционный и пролиновый углы соответственно по возрастанию размеров шариков.


Транспозиционный угол откладывается по шкале, которая лежит в перпендикулярной плоскости к шкале композиционных углов


 





Изгиб на сустве Pro, модель


https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/NuxvsGJ4bavr1w







Содержание 2D диаграммы Пикотех



СОКРАЩЁННАЯ ДИАГРАММА


Красный - альфа-спираль.
Оранжевый - 310-спираль.
Розовый - одиночный код альфа/310 спиралей.
Голубой - пи-спираль.
Зеленый - бета-спираль.
Сиреневый - метиониновая спираль. У неё более крупный шаг "резьбы", чем у обычной альфа-спирали.

Жёлтый - сустав пролина
Черный в сокращённом представлении и белый в развернутом означают либо неизвестный код, либо конец трансляции.
Циклическое повторение цветов - программная спираль.


https://img-fotki.yandex.ru/get/898391/158289418.498/0_1859fc_e2e79c6_orig.png




ПОЛНАЯ ДИАГРАММА


Содержание столбцов


1 - порядковый номер аминокислотного остатка в белковой молекуле
2 - триплетный код
3 - однобуквенный код аминокислотного остатка
4 - трёхбуквенное обозначение аминокислотного остатка
5 - упрощённый композиционный код
6 - графическая интерпретация упрощенного композиционного кода
7 - композиционный код
8 - графическая интерпретация композиционного кода
9 - нота, которая звучит при установке данной аминокислоты в растущую белковую цепь
10 - графическое изображение ноты (или ударного инструмента)
Для версии Пикотех 2018 разработан Композиционный код 7var и 8var

Для версии 2019 разработан Композиционный код  9var

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/iJwUNQdQNAIUrg


Программные спирали - повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).
1111111111111111111 - прямая альфа-спираль
4444444444444444444 - прямая 310-спираль
3333333333333333333 - прямая пи-спираль
2222222222222222222 - прямая бета-спираль
232323 - программная 23-спираль
141414 - программная 14-спираль







УСЛОВНЫЕ  ОБОЗНАЧЕНИЯ



https://img-fotki.yandex.ru/get/509063/158289418.498/0_1859fd_27b43600_orig.png










34343(Q-спираль) и 14141(QVQVQ-спираль)

в  Thioalkalivibrio nitratireducens DSM 14787 protein



http://www.ebi.ac.uk/ena/data/view/AGA34115&display=text


>ENA|AGA34115|AGA34115.2 Thioalkalivibrio nitratireducens DSM 14787 hypothetical protein 


TTGACTCGGGCTTGGACTCGGGCTCGGGTTCCGGCTCAGGCTCGGGTTCCGGCTCAGGCT
CGGGTTCCGGCTCAGGCTTGGGTTCCGGCTCAGGCTCGGGTTCCGGCTCGGGTTCCGGCT
CGGGTTCCGGCTCGGGTTCCGGCTCGGGTTCCGCGGCTCGGGCTCCGGCTCCGGCTCCGG
CTCCGGCTCCGGCTTCGGCTCGGGTTCCGGCTCGGGTTCCGGCTCGGGTTCCGGCTCGGG
TTCCGGCTCGGGCTCCGGCTCCGGCTCGGGTTCCGGCTCGGGTTCCGGCTCGGAACCGAG
TTGTGCGTTATCGATTTCGTCAGTGGTCGGCAGATCCTCGGGAGGAGCCGGGGGAAGCGT
CAGGTCCCCCAGCTCGATCCAGCTTGCCTGCATGCCCCCGCGTCCGAGATCGAGGGTCGC
CTGGCTCGCCTGCCAAACGACCAGACCGCCCACCGCGGCCCCGTGCAACGCGAGGCTCGC
AAGAATCCCGAGCGCTAG


https://img-fotki.yandex.ru/get/96803/158289418.3e3/0_176a46_fcaf1113_orig.png





Locus AGA34115
FT   CDS 1..498
     ttgactcggg cttggactcg ggctcgggtt ccggctcagg ctcgggttcc ggctcaggct
     cgggttccgg ctcaggcttg ggttccggct caggctcggg ttccggctcg ggttccggct
     cgggttccgg ctcgggttcc ggctcgggtt ccgcggctcg ggctccggct ccggctccgg
     ctccggctcc ggcttcggct cgggttccgg ctcgggttcc ggctcgggtt ccggctcggg
     ttccggctcg ggctccggct ccggctcggg ttccggctcg ggttccggct cggaaccgag
     ttgtgcgtta tcgatttcgt cagtggtcgg cagatcctcg ggaggagccg ggggaagcgt
     caggtccccc agctcgatcc agcttgcctg catgcccccg cgtccgagat cgagggtcgc
     ctggctcgcc tgccaaacga ccagaccgcc caccgcggcc ccgtgcaacg cgaggctcgc
     aagaatcccg agcgctag
//

https://img-fotki.yandex.ru/get/52127/158289418.3e3/0_176a8c_f8137db4_orig.gif

https://img-fotki.yandex.ru/get/197807/158289418.3e3/0_176a8d_7fce694f_XL.png

https://img-fotki.yandex.ru/get/197756/158289418.3e3/0_176a90_e00cc5d2_XL.png




БЕЛОК, ИМЕЮЩИЙ ФОРМУ И РАЗМЕРЫ 25 СТУПЕНЕЙ ДНК



Случайное совпадение формы моедли белка и ДНК исключено.  Совпадают внутренний и внешний радиус, шаг спирали,количество ступеней на виток.



>PGOL01007770.1:c3269-1 Punica granatum strain AG2017 PG007770, whole genome shotgun sequence
atccaaggatgggactcggcctggggaagatctaacgatgggattcggcccaacgaaaga
tcaaaggttgggactcggcccagggggagatctaacgatgggactcagccctacggaaga
tcaaaggttgggactcgtccctgggggagatctaacgatgcgactcggccctacgaaagt
tcaaaggatgggactcggccctgggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactcggccctgtgggagatctaacgatgcgactcggccctacggaaga
tcaaaggttgggactccgcccagggggagatctaacggtgggactcggccctacggaaga
tcaaaggttgggactcggctctgggggagatctaacgatgagactcggccctacgaaaga
tcaaaggatgggactcggcccagggggagatctaa


https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/nDFBwgyC-6zzOA
Развернуть: https://yadi.sk/i/K9jwT9lakQ0zAA
Слушать(MIDI): https://yadi.sk/d/UIhJRsRH669gyw

Программная спираль строится в 40-дольном музыкальном размере.

Структуры белков такого типа могут наглядно продемонстрировать триумф пикотехнологии белков.


https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/YWhzsoqRaw5E3w

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/X2zaTRlKbAPevw

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/02o8pb1oj0DUCg

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/5cDhg4KlmVkmRQ

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/AqNvNU1_DMpjKg




Модель ДНК

http://nanoworld88.narod.ru/data/248_files/0_5197a_14ad55f9_L.png



Модель молекулы



https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/RbV-Te2qx0hyPw

Полновесная анимация (avi, 63Mb): https://yadi.sk/i/cdixlJKwoI9Eyw




https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/tRyTwNarkCi-CA
Полновесная анимация (avi, 27Mb): https://yadi.sk/i/g9qzgoDeH12mMA



Обратите внимание на пары радикалов лизина (Lys).

По каждому азтистому основанию ДНК/РНК сользят лизиновые "салазки",  ориентация которых согласована в пространстве.


https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/zzGCvdTc9UUHHA








Композиционный генетический код  4var, 6var, 7var, 8var и 9var


В Диграммах Пикотех применяются три вида композиционного генетического кода – коды 4var, 6var и 7var. 
Код "2" (спираль - не спираль).
Код 4var более подробный (альфа-, бета-, пи-, 310-).
Код 6var ещё более подробный. В нём есть различие "одиночный альфа-код", "код альфа-спирали", "код 310-спирали", "Код метионина в составе спирали". 
Код 7var  различает одиночный код пи-спирали от кода в составе пи-спирали .

Код 8var  различает одиночный код бета-спирали 

Код 9var различает пролин в конце спирали


В настоящее время считается, что белок в неопознанной части структур, полученных методом РСА, не имеет определенной структуры, но пикотехнология показала, что это не так. В программе "Пикотех" вся структура определена.


Пикотехнология не может определить структуры, полученные не по программе рибосомой. Если после сборки белка он обработан ферментами, например, разрезан и переделан, то программа "Пикотех" об этом не даёт информации.






Построение 2D Диаграмм и структур 3D Пикотех


Алгоритм построения Пикотехнологических моделей белков основан на открытии Композичионного генетического кода, см. монографию А.КУшелева и В.Соколик "Геометрия живого наномира. Пикотехнология белков".


Структуры  2D Пикотех строятся с достоверностью 100% в автоматическом режиме.  Структуры 3D Пикотех  в зависимости от состава молекул строятся в автоматическом режиме (геометрический алгоритм) либо в ручном режиме (с учётом физико-химических взаимодействий и свойств сустава Pro). Метод построения структур 3D Пикотех на базе 2D структур Пикотех является ноу-хау Лабораторатории Наномир.


Пикотехнологическая модель гистонного комплекса
http://nanoworld.org.ru/post/96354/#p96354


Пикотехнологические 2D и 3D модели длинных спиралей 

http://nanoworld.org.ru/topic/1837/ http://nanoworld.org.ru/post/91815/#p91815 , http://nanoworld.org.ru/topic/1656/page/5/ 





Три надежных метода проверки Пикотехнологии


Первый - достоверная корреляция с данными РСА. Конечно, РСА не даёт высокой достоверности, но она часто выше 50%.

На таких белках, как инсулин, гемоглобин, окситоцин корреляция приближается к 100%, т.к. в окситоцине, например, есть замкнутые циклы через дисульфидные мостики. Это позволяет проверить и РСА, и Пикотех.


Второй - замкнутые через дисульфидные мостики циклы типа окситоциновых. Вероятность случайного замыкания шести циклов, насчитывающих десятки аминокислотных остатков из разных окситоцинов, порядка 1/30 000 000 000. Речь идёт о вероятности для каждого цикла - все шесть могут случайно замкнуться с вероятностью (1/30 000 000 000)^6.


Третий - самоповерка на примере сверхдлинных базовых и программных спиралей, где наблюдается 100%-ная корреляция между вторичной и первичной структурами.


Четвёртый - микроскопия. 3D модель "монстра" первой хромосомы хороша тем, что её можно проверить, рассматривая молекулу белка в флуоресцентный микроскоп. "Монстр" первой хромосомы такой крупный, что его  видно в микроскоп в отличие от мелких белков. В частности, диаметр начальной фрактальной петли (правая часть) примерно 100 нанометров,  т.е. 0.1 микрона. 


https://img-fotki.yandex.ru/get/874316/158289418.4bc/0_18a505_811b15df_orig.gif

https://img-fotki.yandex.ru/get/9494/158289418.4bc/0_18a589_4694862e_orig.gif









ДИФРАКЦИОННЫЕ НЕЗАСЛОНЯЕМЫЕ ШКАЛЫ ДЛЯ МОЛЕКУЛЯРНОЙ БИОЛОГИИ


Эффект обратной дифракции делает возможным  создание незаслоняемой дифракционной шкалы на основе органических молекул, в частности, белковых. Это позволит произвести "геодезическую разметку" в микромире и точно измерить его объекты.










ПИКОТЕХНОЛОГИЯ КАК ДОПОЛНЕНИЕ К РЕНТГЕНО-СТРУКТУРНОМУ АНАЛИЗУ


Программа Пикотех не может полностью заменить РСА.


Однако она очень усиливает самые слабые стороны РСА, а именно достоверно показывает вторичную структуру и ближний порядок расположения атомов третичной структуры в момент сборки белковой молекулы рибосомой.


Чувствительность РСА такова, что он не замечает не только отдельных атомов, но и отдельных аминокислотных остатков. Более того, "хвосты" белковых молекул, которые не кристаллизуются, РСА вообще "не видит", а эти "хвосты" могут насчитывать до 50 аминокислотных остатков.


Особый класс образуют 97% белковых молекул, которые не кристаллизуются. Про них РСА просто ничего не знает, а программа Пикотех так же достоверно показывает их вторичную структуру и ближний порядок расположения атомов в третичной структуре.







КОЛЛАГЕН - НЕ ТРОЙНАЯ, А ПРОГРАММНАЯ 335-СПИРАЛЬ


Модель коллагена (программная 335-спираль) -  яркая демонстрация несовершенства рентгеноструктурного анализа. Специалисты по РСА конструируют спираль коллагена из того, что им известно. А известна им альфа-спираль. Вот они и сконструировали модель из 3 альфа-спиралей. Программа Пикотех показывает, что это не тройная, а одинарная, но программная 335-спираль. Радикалы аминокислот действительно располагаются в виде трёх-заходной спирали, что и сбило с толку специалистов по РСА.

Другие программные спирали специалисты по РСА тоже ошибочно интерпретируют известными им "базовыми спиралями", но настало время показать, как устроены реальные, программные спирали белков.

Другими яркими примерами, демонстрирующими несостоятельность РСА, являются  сверхдлинные, в том числе программные спирали.

Наконец, Пикотехнология в отличие от РСА имеет возможность самоповерки. В частности, самоповеркой является 100%-ная корреляция между первичной и вторичной структурой некоторых белков, например, сверхдлинных программных спиралей. Спирали длиной более 1000 витков исключают случайные совпадения, согласитесь. Например, вероятность случайного совпадения композиционных кодов для 310-спирали длиной более 3982 аминокислотных остатков не превышает 4^-3982=2.5*10^-2397, т.е. более двух тысяч нулей после запятой.    

Подробнее об этом белке можно прочесть здесь.

 

https://www.ncbi.nlm.nih.gov/nuccore/902935724

>ENA|XP_013055863|102 nucleotides
cctggtccccctggtccccctggtccccctggtccccctggtccccctggtccccctggt
ccccctggtccccctggtccccctggtccccctggtccccct

https://img-fotki.yandex.ru/get/62989/158289418.420/0_17aa9b_9413827f_orig.png



https://img-fotki.yandex.ru/get/195990/158289418.420/0_17aab4_fce4e23_orig.gif









ФРАКТАЛЬНАЯ ПРОГРАММНАЯ  257575-СПИРАЛЬ

https://www.ncbi.nlm.nih.gov/nuccore/523901990


Понятно, что здесь должны быть другими как минимум транспозиционные углы. Очевидно, что витки программной спирали должны взаимодействовать друг с другом, образуя более прочную фрактальную структуру. Дальний порядок восстановить ещё труднее. Видно, что полувитки программной 57-спирали поворачиваются на кодах "2" примерно на прямой угол, а значит участки программной спирали могут образовать реберный многогранник или аналогичную реберную конструкцию. Остатков Pro в структуре не встречается, поэтому скорее всего это - жесткая конструкция, хотя за счет транспозиционных связей может где-то и гнуться.


https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/Buugjfttz0skZg


https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/-q3kGZl0MsH02A

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/dkkddUg7TwTMfg









РЕНТГЕНО-СТРУКТУРНЫЙ АНАЛИЗ НЕ РАЗЛИЧАЕТ АЛЬФА-СПИРАЛИ И ПИ-СПИРАЛИ, А ТАКЖЕ ДРУГИЕ ДЕТАЛИ

 Online service "ProteinPicotech"


Aequorea victoria isolate sGFP-206 green fluorescent protein (gfp) gene


https://www.ncbi.nlm.nih.gov/nuccore/JX472995.1?report=fasta


ДАННЫЕ 2D  ДИАГРАММЫ ПИКОТЕХ


2D диаграмма Пикотех показывает, что в структуре есть  4 пи-спиральных (синий) и 2 альфа-спиральных (красный) участка.  Есть ещё и виток 310-спирали (оранжевый), но такие "мелочи" РСА не замечает .

Бета-спиралей и тем более слоёв из бета-спиралей в белке GFP нет вообще. Это - ошибки РСА 

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/ACojshkbramQIw





ДАННЫЕ РЕНТГЕНО-СРУКТУРНОГО АНАЛИЗА


Вторичная структура из пяти α-спиралей и один одиннадцать слоёв  β-спирали


https://proteopedia.org/wiki/images/2/26/Green_Fluorescent_Protein.gif 



https://upload.wikimedia.org/wikipedia/commons/b/b1/Steel_Jellyfish_%28GFP%29.jpg









Human herpesvirus 3 strain Dumas transcriptional regulator

УВЕЛИЧИТЬ







ПИКОТЕХНОЛОГИЧЕСКАЯ МОДЕЛЬ КОЛЛАГЕНА











ПИКОТЕХНОЛОГИЧЕСКАЯ МОДЕЛЬ ИНСУЛИНА








Литература


1.Монография А.Кушелев, В.Соколик "Геометрия живого наномира. Пикотехнология белков"  https://www.morebooks.de/ru/search?utf8 … 0%BE%D0%B2  
Предисловие рецензентов и авторов http://nanoworld.org.ru/post/55717/#p55717 
Ознакомиться с началом монографии можно по ссылке http://nanoworld.org.ru/post/54741/#p54741 
2.    Кушелев А.Ю., Соколик В.В. Пикотехнология – новый подход в моделировании пространственной структуры белка / Заочная Международная научно-практическая конференция «Современная наука: тенденции развития» (24 января 2012), Краснодар: НИЦ Априори. – 2012. – С.203-207.
3.    Соколик В.В. Предсказание пространственной структуры белка insilico на основе информации генома и геометрического алгоритма – альтернатива  квантово-механическому подходу // Материалы Международной научной конференции «Математическое и компьютерное моделирование в биологии и химии. Перспективы развития» (28-30 мая 2012), Казань. – 2012. – С.155-158.
4.    Sokolik V.V. Protein is coded in genome and synthesized in ribosomes as a structural template of a rotameric version sequence of peptide bound configuration // The International Moscow Conference on Computational Molecular Biology, МССМВ-11, Moscow. – 2011. – P. 347–348.
5.    Sokolik V.V. Algorithm of protein structural template decoding according to its determined nucleotide sequence // Fist International Conference “Fundamental medicine: From scalpel toward Genome, Proteome and Lipidome”, Pax Grid Virtual Conferences, Kazan. – 2011. – P. 117–119.
6.    Sokolik V.V. Modeling of the individual structural template of protein on determining it nucleotide sequences // VII Международная конференция по биоинформатике, регуляции структуры геномов и системной биологии. BGRS\SB-2010, Новосибирск. – 2010. – С. 275.
7.    Соколик В.В. Способ моделирования пространственной структуры белка по детерминирующей его нуклеотидной последовательности // Биофизический вестник. – 2010. – Вып. 24 (1). – С. 31-45.

http://nanoworld.org.ru/post/96761/#p96761



Коммерческая реализация

Подписаться на RSS

Доступны структуры белков, кодируемых 1(1812 структур из 11 046), 2, 3, 4, 5, 8, 9, 11, 12, 13, 14, 16, 18, 19, 20, 21, 22, 23(X), 24(Y)-хромосомами человека

На сегодняшний день Лабораторией Наномир по методу Пикотехнологии выполнена база белковых структур "Human Genome Protein", расположенная по этим адресам:

Part 1: https://cloud.mail.ru/public/BJeH/PdR6tFSsR

Part 2: https://cloud.mail.ru/public/Jxkq/Yt3GQAcC8

База содержит структуры всех белков человека, для которых известна нуклеотидная последовательность 

(24 хромосомы, 114 419 кодирующих нуклеотидных последовательностей).


Посмотрите выборочные примеры структур белков, кодируемых 1  23, 

3-14, 5, 78,  9, 101112, 13, 14, 16, 17, 18 20, 21, 22(Y) хромосомами человека, а также примеры некоторых других "монстров" хромосом по ссылке .

Всего у человека 24 хромосомы. Общее число белков около 5 000 000. 


С помощью рентгеноструктурного анализа за всю историю его существования, во всех странах вместе взятых смогли определить около 100 000 структур белка. И то - половина неправильно. Это обошлось заказчикам в миллиард долларов. 


Все белки человека рентген не покажет даже за триллион триллионов долларов -  только 3%, которые кристаллизуются.

Для их исследования методом РСА не хватит и миллиона лет.


Мы выполним точную пикоструктуру интересующего Вас белка за неделю.


Для исследователей разработана удобное графическое представление 2D и 3D структур Пикотех гигантских бековых молекул.


Ваша заявка должна содержать лишь код интересующего Вас белка из базы данных PDB, либо мРНК для него.




Обращение к специалистам в области ренгено-структурного анализа, биоинформатики, биоматематики, медицинской биофизики и биохимии, других профильных и смежных областей

Пикотехнология вкратце

10 из 29 Подписаться на RSS

Вращение аминокислотных остатков вокруг оси тРНК






АЛЬФА-СПИРАЛЬ


БЕТА-СПИРАЛЬ


ПИ-СПИРАЛЬ


МОДЕЛИРОВАНИЕ ПИКОТЕХНОЛОГИЧЕСКИХ МОДЕЛЕЙ НА 3D ПРИНТЕРЕ



https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/6HSSj0u667jqPQ



https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/cxbHEXZkLqLqyQ



По шкале, изображенной в виде фрактального эталона, меняется значение композиционного угла.


Транспозиционный угол откладывается по шкале, которая лежит в перпендикулярной плоскости к шкале композиционных углов


Диапазоны и взаимная ориентация шкал изменения композиционного и транспозиционного углов показывают, что сборка белковой молекулы может идти почти по полному телесному углу на каждом шаге. Библиотеку готовых 3D конструкций можно взять из  геномов разных организмов.


Красная отметка (принадлежит кольцевому электрону, центр которого находится в плоскости текущей пептидной группы) совмещается с кольцевым электроном предыдущего аминокислотного остатка, центр которого находится в плоскости симметрии предыдущей пептидной группы.


После того, как очередной аминокислотных остаток добавился в модель белка, модель продвинулась, повернулась и далее поворачивается уже на транспозиционный угол, значение которого меняется по шкале из более крупных шариков.


Транспозиционный угол фиксирован в альфа-, 310- и пи-спирали, но в каждой из них принимает своё значение. В бета-спирали он может меняться, если нет периодических водородных связей между соседними бета-спиралями, образующими бета-слой. В программных спиралях он периодически меняется, т.е. достаточно определить транспозиционные углы только для одного периода программной спирали.










Пикотехнология трансляции

http://img-fotki.yandex.ru/get/4515/nanoworld2003.29/0_4f985_f662331c_orig.gif


Метилинозин срезает продольную диэфирную связь, оставляя триплет иРНК на антикодоновой петле тРНК. тРНК продолжает по инерции вращаться, пока третий нуклеотид кодона иРНК не встретит комплементарное основание на сайте рибосомы.
Третий нуклеотид триплета терминирует угол поворота тРНК в рибосоме. После этого аминокислота устанавливается в растующую белковую молекулу под нужным углом. 


Читать полностью

Пикотехнолгия помогла найти ошибки рентгено-структурного анализа

*

*

Пикотехнологические программные спирали белка


Модель коллагена (программная 335-спираль) -  яркая демонстрация несовершенства рентгеноструктурного анализа. Специалисты по РСА конструируют спираль коллагена из того, что им известно. А известна им альфа-спираль. Вот они и сконструировали модель из 3 альфа-спиралей. Программа Пикотех показывает, что это не тройная, а одинарная, но программная 335-спираль. Радикалы аминокислот действительно располагаются в виде трёх-заходной спирали, что и сбило с толку специалистов по РСА.

Другие программные спирали специалисты по РСА тоже ошибочно интерпретируют известными им "базовыми спиралями", но настало время показать, как устроены реальные, программные спирали белков.

Другими яркими примерами, демонстрирующими несостоятельность РСА, являются  сверхдлинные, в том числе программные спирали.

Наконец, Пикотехнология в отличие от РСА имеет возможность самоповерки. В частности, самоповеркой является 100%-ная корреляция между первичной и вторичной структурой некоторых белков, например, сверхдлинных программных спиралей. Спирали длиной более 1000 витков исключают случайные совпадения, согласитесь. Например, вероятность случайного совпадения композиционных кодов для 310-спирали длиной более 3982 аминокислотных остатков не превышает 4^-3982=2.5*10^-2397, т.е. более двух тысяч нулей после запятой.    

Подробнее об этом белке можно прочесть здесь.

 


https://img-fotki.yandex.ru/get/4000/158289418.421/0_17aaf5_65d3d6c0_orig.gif

Открыт новый тип белковой структуры - метиониновая спираль


*

*

Метиониновая спираль


В отличие от альфа-спирали у метиониновой спирали более длинный шаг. Метиониновая спираль отличается от обычной альфа-спирали примерно как резьба с более крупным шагом от резьбы с менее крупным шагом

 



Вероятность замыкания дисульфидных мостиков в лизоцимах

*

*

 

Вероятность случайного совпадения результата работы геометрического алгоритма с экспериментальными данными для первых  5 участков не превышает 4^-(18+21+4+4+12)=4^-59

Cys 95 - Cys 113 в человеческом лизоциме.
Cys 96 - Cys 117 в альтернативном человеческом лизоциме.
Cys 78 - Cys 82  в альтернативном человеческом лизоциме.
Cys 94 - Cys 98  в лизоциме куриного яйца
Met 1 - Cys 13  в мышином лизоциме
Met 1 - Cys 24  в лизоциме куриного яйца 

1. 4^-18
2. 4^-21
3. 4^-4
4. 4^-4
5. 4^-12

6. 4^-23



Убедительны ли модельные эксперименты?


Фрагменты моделей белков, замкнувшихся через дисульфидные мостики в процессе автоматической сборки по таблице композиционного генетического кода.


https://img-fotki.yandex.ru/get/107080/158289418.3c1/0_1705b1_dc9f55fd_M.gif https://img-fotki.yandex.ru/get/169883/158289418.3b3/0_16f622_63ae0418_M.gif
https://img-fotki.yandex.ru/get/53993/158289418.3c3/0_170898_94d9b5cd_orig.gif https://img-fotki.yandex.ru/get/98619/158289418.3c3/0_1706b3_7dab967d_orig.gif






Вторичные структуры и 3D модели в Пикотехнологии

​*

​*

​*





2D  структуры Пикотех                                    






3D структуры Пикотех                               




Тест Пикотех, информативность

для ренгено-структурного анализа, работоспособность моделей Пикотехнологии




Особенности построения моделей 3D Пикотех на основе структур 2D пикотех













2D диаграммы Пикотех

белковых структур,

исследованных методом РСА












Повороты спиралей на пролине












Александр Кушелев


Структура 2D диаграммы Пикотех и примеры моделей 3D Пикотех

*

*

СОКРАЩЁННАЯ ДИАГРАММА


Красный - альфа-спираль.
Оранжевый - 310-спираль.
Розовый - одиночный код альфа/310 спиралей.
Голубой - пи-спираль.
Зеленый - бета-спираль.
Сиреневый - метиониновая спираль. У неё более крупный шаг "резьбы", чем у обычной альфа-спирали.
Черный в сокращённом представлении и белый в развернутом означают либо неизвестный код, либо конец трансляции.
Циклическое повторение цветов - программная спираль.


ПОЛНАЯ ДИАГРАММА


Содержание столбцов
1 - порядковый номер аминокислотного остатка в белковой молекуле
2 - триплетный код
3 - однобуквенный код аминокислотного остатка
4 - трёхбуквенное обозначение аминокислотного остатка
5 - упрощённый композиционный код
6 - графическая интерпретация упрощенного композиционного кода
7 - композиционный код
8 - графическая интерпретация композиционного кода
9 - нота, которая звучит при установке данной аминокислоты в растущую белковую цепь
10 - графическое изображение ноты (или ударного инструмента)
Для новой версии Пикотех 2018 разработан Композиционный код 7var
https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae92_83cc91e_orig.jpg


Программные спирали - повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).
1111111111111111111 - прямая альфа-спираль
4444444444444444444 - прямая 310-спираль
3333333333333333333 - прямая пи-спираль
2222222222222222222 - прямая бета-спираль
232323 - программная 23-спираль
141414 - программная 14-спираль



Пример программных спиралей



Программная 1111223553355532114135322332-спираль. Период 28 аминокислотных остатков.

https://img-fotki.yandex.ru/get/5411/158289418.42a/0_17b200_1f6190d0_orig.png

Программная 111135332332-спираль. Период 12 аминокислотных остатков.

https://img-fotki.yandex.ru/get/143523/158289418.42a/0_17b1fb_633f86a8_orig.png


https://img-fotki.yandex.ru/get/198786/158289418.42a/0_17b1f6_680c4b41_XL.png





Многослойные белковые спирали и мезо-механизмы

*

*

Подробные примеры

https://img-fotki.yandex.ru/get/896238/158289418.4a6/0_186ba1_52a77613_XL.png


Эта структура вообще может быть Т-конструкцией из двухслойной спирали.

Сначала строится верхняя черта Т из 310-спирали длиной 38 аминокислотных остатков. Затем поверх нее укладывается второй слой (пи-спираль длиной 17 АО), покрывая процентов 20...25 310-спирали. Потом идёт шпилька из 310-спирали длиной 8 АО (примерно 0.21 от "верхней черты"). Далее обратным ходом на шпильку укладывается 19 АО пи-спирали. После этого строится 28 АО альфа-спирали, которая может идти под любым углом, т.е. от нуля до 180 к первоначальной "черте" или к шпильке. Кстати, шпилька тоже может быть расположена под любым углом к "черте". Далее идёт 310-спираль длиной 45 АО и альфа-спираль длиной 53 АО. Последние три участка - это сверхдлинная прямая спираль (28+45+53 АО), которая тоньше в средней части. Наконец, идёт пи-спираль, например, поверх альфа-спрали и какой-то хитрый узел. Всё это может иметь форму рогатки из двухслойной пи-альфа-спирали на всех трех концах. Может быть и сравнительно  низкочастотной резонансной системой, похожий на U-образный музыкальный камертон. С этим интересно было бы разобраться...



https://img-fotki.yandex.ru/get/896349/158289418.4a5/0_1863ba_ccc834d4_XL.png



Эта структура может быть либо антинаправленными участками альфа-спиралей и двухслойных 310-пи-спиралей, образующих гигантскую трубу, либо рёберным многогранником, в частности 6-угольной пирамидой, основание которой образовано альфа-спиральными участками, а наклонные ребра - двухслойными 310-пи-спиралями. При этом пирамида может быть лишь одним из крайних состояний некого манипулятора, который может развернуться в 6-конечную "звезду". Это нужно моделировать в 3D. Тогда может появиться определенность и ясность.


Уточнение 2D структур некоторых белков, взятых из базы NCBI, методом Пикотех

*

*Посмотреть примеры пяти полных 2D Диаграмм Пикотех

https://img-fotki.yandex.ru/get/880375/249950893.0/0_16a3b7_7315a46a_orig.png

https://img-fotki.yandex.ru/get/893753/249950893.1/0_16aff1_b0049741_orig.png

Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.





https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcd_1b4a76df_orig.png

https://img-fotki.yandex.ru/get/509739/249950893.1/0_16b0a0_f8fd49ff_orig.png


147-173 - наиболее протяженный участок альфа-310-спирали. 
Весь белок представлен преимущественно участками альфа-310-спиралей.

Сделать сайт на
конструкторе сайтов