Перевести страницу

Пикотехнология вкратце

Уточнение 2D структур некоторых G-белков, взятых из базы NCBI, методом Пикотех

2017.12.05 17:53:30



    2D диаграммы Пикотех белковых структур, исследованных методом РСА, версия 2017 года 6var.




    СТРУКТУРА ДИАГРАММЫ ПИКОТЕХ 


     

    СОКРАЩЁННАЯ ДИАГРАММА
    Красный - альфа-спираль.
    Оранжевый - 310-спираль.
    Розовый - одиночный код альфа/310 спиралей.
    Голубой - пи-спираль.
    Зеленый - бета-спираль.
    Сиреневый - метиониновая спираль. У неё более крупный шаг "резьбы", чем у обычной альфа-спирали.
    Черный в сокращённом представлении и белый в развернутом означают либо неизвестный код, либо конец трансляции.
    Циклическое повторение цветов - программная спираль.

    ПОЛНАЯ ДИАГРАММА
    Содержание столбцов
    1 - порядковый номер аминокислотного остатка в белковой молекуле
    2 - триплетный код
    3 - однобуквенный код аминокислотного остатка
    4 - трёхбуквенное обозначение аминокислотного остатка
    5 - упрощённый композиционный код
    6 - графическая интерпретация упрощенного композиционного кода
    7 - композиционный код
    8 - графическая интерпретация композиционного кода
    9 - нота, которая звучит при установке данной аминокислоты в растущую белковую цепь
    10 - графическое изображение ноты (или ударного инструмента)
    Для новой версии Пикотех 2018 разработан Композиционный код 7var
    https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae92_83cc91e_orig.jpg

    Программные спирали - повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).


    1111111111111111111 - прямая альфа-спираль
    4444444444444444444 - прямая 310-спираль
    3333333333333333333 - прямая пи-спираль
    2222222222222222222 - прямая бета-спираль
    232323 - программная 23-спираль
    141414 - программная 14-спираль











    1.
    https://www.ncbi.nlm.nih.gov/Structure/ … p;uid=5TUD

    Structural insights into the extracellular recognition of the human serotonin 2B receptor by an antibody

    Ishchenko A, Wacker D, Kapoor M, Zhang A, Han GW, Basu S, Patel N, Messerschmidt M, Weierstall U, Liu W, Katritch V, Roth BL, Stevens RC, Cherezov V

    https://img-fotki.yandex.ru/get/880375/249950893.0/0_16a3b7_7315a46a_orig.png

    https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

    >ENA|CAA54513|CAA54513.1 Homo sapiens (human) 5-HT2B serotonin receptor 
    ATGGCTCTCTCTTACAGAGTGTCTGAACTTCAAAGCACAATTCCTGAGCACATTTTGCAG
    AGCACCTTTGTTCACGTTATCTCTTCTAACTGGTCTGGATTACAGACAGAATCAATACCA
    GAGGAAATGAAACAGATTGTTGAGGAACAGGGAAATAAACTGCACTGGGCAGCTCTTCTG
    ATACTCATGGTGATAATACCCACAATTGGTGGAAATACCCTTGTTATTCTGGCTGTTTCA
    CTGGAGAAGAAGCTGCAGTATGCTACTAATTACTTTCTAATGTCCTTGGCGGTGGCTGAT
    TTGCTGGTTGGATTGTTTGTGATGCCAATTGCCCTCTTGACAATAATGTTTGAGGCTATG
    TGGCCCCTCCCACTTGTTCTATGTCCTGCCTGGTTATTTCTTGACGTTCTCTTTTCAACC
    GCATCCATCATGCATCTCTGTGCCATTTCAGTGGATCGTTACATAGCCATCAAAAAGCCA
    ATCCAGGCCAATCAATATAACTCACGGGCTACAGCATTCATCAAGATTACAGTGGTGTGG
    TTAATTTCAATAGGCATTGCCATTCCAGTCCCTATTAAAGGGATAGAGACTGATGTGGAC
    AACCCAAACAATATCACTTGTGTGCTGACAAAGGAACGTTTTGGCGATTTCATGCTCTTT
    GGCTCACTGGCTGCCTTCTTCACACCTCTTGCAATTATGATTGTCACCTACTTTCTCACT
    ATCCATGCTTTACAGAAGAAGGCTTACTTAGTCAAAAACAAGCCACCTCAACGCCTAACA
    TGGTTGACTGTGTCTACAGTTTTCCAAAGGGATGAAACACCTTGCTCGTCACCGGAAAAG
    GTGGCAATGCTGGATGGTTCTCGAAAGGACAAGGCTCTGCCCAACTCAGGTGATGAAACA
    CTTATGCGAAGAACATCCACAATTGGGAAAAAGTCAGTGCAGACCATTTCCAACGAACAG
    AGAGCCTCAAAGGTCCTAGGGATTGTGTTTTTCCTCTTTTTGCTTATGTGGTGTCCCTTC
    TTTATTACAAATATAACTTTAGTTTTATGTGATTCCTGTAACCAAACTACTCTCCAAATG
    CTCCTGGAGATATTTGTGTGGATAGGCTATGTTTCCTCAGGAGTGAATCCTTTGGTCTAC
    ACCCTCTTCAATAAGACATTTCGGGATGCATTTGGCCGATATATCACCTGCAATTACCGG
    GCCACAAAGTCAGTAAAAACTCTCAGAAAACGCTCCAGTAAGATCTACTTCCGGAATCCA
    ATGGCAGAGAACTCTAAGTTTTTCAAGAAACATGGAATTCGAAATGGGATTAACCCTGCC
    ATGTACCAGAGTCCAATGAGGCTCCGAAGTTCAACCATTCAGTCTTCATCAATCATTCTA
    CTAGATACGCTTCTCCTCACTGAAAATGAAGGTGACAAAACTGAAGAGCAAGTTAGTTAT
    GTATAG

    http://nanoworld.org.ru/post/96477/#p96477
    Программа Пикотех показывает следующую детализированную структуру.
    Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
    431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.

    https://img-fotki.yandex.ru/get/893753/249950893.1/0_16aff1_b0049741_orig.png

    https://img-fotki.yandex.ru/get/510105/249950893.1/0_16aff0_89b162aa_orig.png









    2. 
    https://www.ncbi.nlm.nih.gov/Structure/pdb/5V56

    Crystal structure of a multi-domain human smoothened receptor in complex with a super stabilizing ligand

    Zhang X, Zhao F, Wu Y, Yang J, Han GW, Zhao S, Ishchenko A, Ye L, Lin X, Ding K, Dharmarajan V, Griffin PR, Gati C, Nelson G, Hunter MS, Hanson MA, Cherezov V, Stevens RC, Tan W, Tao H, Xu F

    https://img-fotki.yandex.ru/get/896238/249950893.1/0_16afce_af6cf2b8_orig.png

    http://www.rcsb.org/pdb/explore/explore … ureId=5V56
    https://www.ebi.ac.uk/ena/data/view/AAA … play=fasta

    >ENA|AAA23367|AAA23367.1 Desulfovibrio vulgaris hypothetical protein 
    ATGCCCAAAGCCCTCATCGTCTACGGTTCCACCACAGGCAACACGGAATACACCGCCGAA
    ACCATCGCACGTGAACTTGCCGATGCAGGGTACGAAGTCGATAGCCGGGACGCGGCCTCT
    GTCGAGGCTGGCGGTCTCTTCGAAGGCTTCGACCTCGTCCTTCTCGGATGCTCGACGTGG
    GGTGACGACTCCATCGAACTGCAGGACGACTTCATTCCCCTTTTCGACTCCCTCGAAGAG
    ACGGGGGCGCAGGGCCGCAAGGTGGCCTGCTTCGGCTGCGGCGACAGTTCCTACGAGTAC
    TTCTGCGGGGCTGTCGACGCCATCGAAGAGAAGCTCAAGAACCTCGGTGCCGAAATCGTT
    CAGGACGGTCTTCGCATCGATGGCGACCCCCGCGCCGCCCGGGACGACATCGTCGGCTGG
    GCGCATGACGTGAGGGGCGCCATCTAG

    http://nanoworld.org.ru/post/96494/#p96494
    Результаты программы Пикотех

    4-8 - альфа-спираль
    49-53 - альфа-спираль
    57-60 - альфа-спираль
    62-65 - альфа-спираль
    67-71 - альфа-спираль
    75-78 - альфа-спираль
    80-95 - альфа-спираль
    97-103 - альфа-спираль
    105-108 - альфа-спираль
    110-115 - альфа-спираль
    115-121 - программная 35-спираль
    120-127 - программная 3355-спираль
    128-141 - альфа-спираль
    143-148 - альфа-спираль

    https://img-fotki.yandex.ru/get/877700/249950893.1/0_16afc9_75560fe6_orig.png

    https://img-fotki.yandex.ru/get/477847/249950893.1/0_16afeb_a12b3edb_orig.png










    3.
    https://www.ncbi.nlm.nih.gov/Structure/pdb/5W0P

    Identification of Phosphorylation Codes for Arrestin Recruitment by G Protein-Coupled Receptors

    Zhou XE, He Y, de Waal PW, Gao X, Kang Y, Van Eps N, Yin Y, Pal K, Goswami D, White TA, Barty A, Latorraca NR, Chapman HN, Hubbell WL, Dror RO, Stevens RC, Cherezov V, Gurevich VV, Griffin PR, Ernst OP, Melcher K, Xu HE

    https://img-fotki.yandex.ru/get/476913/249950893.0/0_16a3b9_61f34840_orig.png

    https://www.ebi.ac.uk/ena/data/view/CAD … play=fasta

    >ENA|CAD97623|CAD97623.1 Homo sapiens (human) hypothetical protein 
    ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTA
    CGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTG
    GCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTAC
    GTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCC
    GTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCAT
    GGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGC
    GGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGT
    AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACC
    TGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCC
    GAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAAC
    GAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTT
    TTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCA
    GCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCT
    TTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGC
    TCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATC
    TACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACC
    ATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACG
    GAGACGAGCCAGGTGGCCCCGGCCTAA

    http://nanoworld.org.ru/post/96490/#p96490
    Программа Пикотех показывает

    8-14 - альфа-спираль.
    21-26 - альфа-спираль.
    28-31 - альфа-спираль.
    35-44 - альфа-спираль.
    46-70 - 310-альфа-спираль.
    72-78 - альфа-спираль.
    83-87 - альфа-спираль.
    90-97 - альфа-спираль.
    102-107 - альфа-спираль.
    112-115 - альфа-спираль.
    117-120 - альфа-спираль.
    124-139 - альфа-спираль.
    141-151 - альфа-спираль.
    153-156 - альфа-спираль.
    158-168 - альфа-спираль.
    172-186 - альфа-спираль.
    189-201 - альфа-спираль.
    204-216 - альфа-спираль.
    215-225 - программная 355-спираль.
    224-233 - альфа-спираль.
    235-239 - альфа-спираль.
    238-248 - программная 255-спираль.
    247-259 - альфа-спираль.
    261-271 - альфа-спираль.
    273-283 - альфа-спираль.
    285-290 - альфа-спираль.
    295-302 - альфа-спираль.
    307-326 - альфа-спираль.
    336-348 - альфа-спираль.

    https://img-fotki.yandex.ru/get/516062/249950893.1/0_16afec_886d280e_orig.png

    https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcc_519f9d05_orig.png













    4.
    https://www.ncbi.nlm.nih.gov/Structure/pdb/5XEZ

    Structure of the full-length glucagon class B G-protein-coupled receptor

    Zhang H, Qiao A, Yang D, Yang L, Dai A, de Graaf C, Reedtz-Runge S, Dharmarajan V, Zhang H, Han GW, Grant TD, Sierra RG, Weierstall U, Nelson G, Liu W, Wu Y, Ma L, Cai X, Lin G, Wu X, Geng Z, Dong Y, Song G, Griffin PR, Lau J, Cherezov V, Yang H, Hanson MA, Stevens RC, Zhao Q, Jiang H, Wang MW, Wu B

    https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcd_1b4a76df_orig.png

    http://www.rcsb.org/pdb/explore/explore … ureId=5XEZ
    http://www.uniprot.org/uniprot/P47871
    https://www.ebi.ac.uk/ena/data/view/AAC … play=fasta

    >ENA|AAC52063|AAC52063.1 Homo sapiens (human) glucagon receptor 
    ATGCCCCCCTGCCAGCCACAGCGACCCCTGCTGCTGTTGCTGCTGCTGCTGGCCTGCCAG
    CCACAGGTCCCCTCCGCTCAGGTGATGGACTTCCTGTTTGAGAAGTGGAAGCTCTACGGT
    GACCAGTGTCACCACAACCTGAGCCTGCTGCCCCCTCCCACGGAGCTGGTGTGCAACAGA
    ACCTTCGACAAGTATTCCTGCTGGCCGGACACCCCCGCCAATACCACGGCCAACATCTCC
    TGCCCCTGGTACCTGCCTTGGCACCACAAAGTGCAACACCGCTTCGTGTTCAAGAGATGC
    GGGCCCGACGGTCAGTGGGTGCGTGGACCCCGGGGGCAGCCTTGGCGTGATGCCTCCCAG
    TGCCAGATGGATGGCGAGGAGATTGAGGTCCAGAAGGAGGTGGCCAAGATGTACAGCAGC
    TTCCAGGTGATGTACACAGTGGGCTACAGCCTGTCCCTGGGGGCGCTGCTCCTCGCCTTG
    GCCATCCTGGGGGGCCTCAGCAAGCTGCACTGCACCCGCAATGCCATCCACGCGAATCTG
    TTTGCGTCCTTCGTGCTGAAAGCCAGCTCCGTGCTGGTCATTGATGGGCTGCTCAGGACC
    CGCTACAGCCAGAAAATTGGCGACGACCTCAGTGTCAGCACCTGGCTCAGTGATGGAGCG
    GTGGCTGGCTGCCGTGTGGCCGCGGTGTTCATGCAATATGGCATCGTGGCCAACTACTGC
    TGGCTGCTGGTGGAGGGCCTGTACCTGCACAACCTGCTGGGCCTGGCCACCCTCCCCGAG
    AGGAGCTTCTTCAGCCTCTACCTGGGCATCGGCTGGGGTGCCCCCATGCTGTTCGTCGTC
    CCCTGGGCAGTGGTCAAGTGTCTGTTCGAGAACGTCCAGTGCTGGACCAGCAATGACAAC
    ATGGGCTTCTGGTGGATCCTGCGGTTCCCCGTCTTCCTGGCCATCCTGATCAACTTCTTC
    ATCTTCGTCCGCATCGTTCAGCTGCTCGTGGCCAAGCTGCGGGCACGGCAGATGCACCAC
    ACAGACTACAAGTTCCGGCTGGCCAAGTCCACGCTGACCCTCATCCCTCTGCTGGGCGTC
    CACGAAGTGGTCTTCGCCTTCGTGACGGACGAGCACGCCCAGGGCACCCTGCGCTCCGCC
    AAGCTCTTCTTCGACCTCTTCCTCAGCTCCTTCCAGGGCCTGCTGGTGGCTGTCCTCTAC
    TGCTTCCTCAACAAGGAGGTGCAGTCGGAGCTGCGGCGGCGTTGGCACCGCTGGCGCCTG
    GGCAAAGTGCTATGGGAGGAGCGGAACACCAGCAACCACAGGGCCTCATCTTCGCCCGGC
    CACGGCCCTCCCAGCAAGGAGCTGCAGTTTGGGAGGGGTGGTGGCAGCCAGGATTCATCT
    GCGGAGACCCCCTTGGCTGGTGGCCTCCCTAGATTGGCTGAGAGCCCCTTCTGA

    http://nanoworld.org.ru/post/96505/#p96505
    Программа Пикотех показывает

    147-173 - наиболее протяженный участок альфа-310-спирали. 
    Весь белок представлен преимущественно участками альфа-310-спиралей.

    https://img-fotki.yandex.ru/get/509739/249950893.1/0_16b0a0_f8fd49ff_orig.png

    https://img-fotki.yandex.ru/get/893904/249950893.1/0_16b0a1_6da31b90_orig.png










    5.
    https://www.ncbi.nlm.nih.gov/pubmed/17962520
    https://www.ncbi.nlm.nih.gov/Structure/ … ;uid=60314

    High-resolution crystal structure of an engineered human beta2-adrenergic G protein-coupled receptor.

    Cherezov V1, Rosenbaum DM, Hanson MA, Rasmussen SG, Thian FS, Kobilka TS, Choi HJ, Kuhn P, Weis WI, Kobilka BK, Stevens RC.

    https://img-fotki.yandex.ru/get/893240/249950893.0/0_16a3b1_d636e8c2_orig.png

    https://www.rcsb.org/pdb/explore/explor … ureId=2RH1

    https://img-fotki.yandex.ru/get/6713/249950893.1/0_16afcf_be7ab3f6_orig.png

    http://www.uniprot.org/uniprot/P00720
    https://www.ebi.ac.uk/ena/data/view/CAA28212

    >ENA|CAA28212|CAA28212.1 Enterobacteria phage T4 hypothetical protein 
    ATGAATATATTTGAAATGTTACGTATAGATGAACGTCTTAGACTTAAAATCTATAAAGAC
    ACAGAAGGCTATTACACTATTGGCATCGGTCATTTGCTTACAAAAAGTCCATCACTTAAT
    GCTGCTAAATCTGAATTAGATAAAGCTATTGGGCGTAATTGCAATGGTGTAATTACAAAA
    GATGAGGCTGAAAAACTCTTTAATCAGGATGTTGATGCTGCTGTTCGCGGAATTCTGAGA
    AATGCTAAATTAAAACCGGTTTATGATTCTCTTGATGCGGTTCGTCGCTGTGCATTGATT
    AATATGGTTTTCCAAATGGGAGAAACCGGTGTGGCAGGATTTACTAACTCTTTACGTATG
    CTTCAACAAAAACGCTGGGATGAAGCAGCAGTTAACTTAGCTAAAAGTATATGGTATAAT
    CAAACACCTAATCGCGCAAAACGAGTCATTACAACGTTTAGAACTGGCACTTGGGACGCG
    TATAAAAATCTATAA



    Версия 2016 года -6var

    https://img-fotki.yandex.ru/get/517809/249950893.1/0_16afd8_c591449d_orig.png

    https://img-fotki.yandex.ru/get/768139/249950893.1/0_16afd9_74627b67_orig.png






    Версия 2018 года - 7var

    Темно-синим цветом показаны пи-спирали, бирюзовым - одиночные АО попи-коду.  Белок состоит преимущественно из пи-спиралей.



    Этот пример демонстрирует, что РСА не от личает пи- от  310- спиралей.