Перевести страницу

Пикотехнология вкратце

Подписаться на RSS

Популярные теги Все теги

Открыт новый тип белковой структуры - метиониновая спираль


*

*

Метиониновая спираль


В отличие от альфа-спирали у метиониновой спирали более длинный шаг. Метиониновая спираль отличается от обычной альфа-спирали примерно как резьба с более крупным шагом от резьбы с менее крупным шагом



Вероятность замыкания дисульфидных мостиков в лизоцимах

*

*

 

Вероятность случайного совпадения результата работы геометрического алгоритма с экспериментальными данными для первых  6 участков не превышает  10^-84

Cys 95 - Cys 113 в человеческом лизоциме.
Cys 96 - Cys 117 в альтернативном человеческом лизоциме.
Cys 78 - Cys 82  в альтернативном человеческом лизоциме.
Cys 94 - Cys 98  в лизоциме куриного яйца
Met 1 - Cys 13  в мышином лизоциме
Met 1 - Cys 24  в лизоциме куриного яйца 

1. 4^-18
2. 4^-21
3. 4^-4
4. 4^-4
5. 4^-12

6. 4^-23



Фрагменты моделей белков, замкнувшихся через дисульфидные мостики в процессе автоматической сборки по таблице композиционного генетического кода.



https://img-fotki.yandex.ru/get/107080/158289418.3c1/0_1705b1_dc9f55fd_M.gif https://img-fotki.yandex.ru/get/169883/158289418.3b3/0_16f622_63ae0418_M.gif








Многослойные белковые спирали и мезо-механизмы

*

*

Подробные примеры



https://img-fotki.yandex.ru/get/896238/158289418.4a6/0_186ba1_52a77613_XL.png


Эта структура вообще может быть Т-конструкцией из двухслойной спирали.

Сначала строится верхняя черта Т из 310-спирали длиной 38 аминокислотных остатков. Затем поверх нее укладывается второй слой (пи-спираль длиной 17 АО), покрывая процентов 20...25 310-спирали. Потом идёт шпилька из 310-спирали длиной 8 АО (примерно 0.21 от "верхней черты"). Далее обратным ходом на шпильку укладывается 19 АО пи-спирали. После этого строится 28 АО альфа-спирали, которая может идти под любым углом, т.е. от нуля до 180 к первоначальной "черте" или к шпильке. Кстати, шпилька тоже может быть расположена под любым углом к "черте". Далее идёт 310-спираль длиной 45 АО и альфа-спираль длиной 53 АО. Последние три участка - это сверхдлинная прямая спираль (28+45+53 АО), которая тоньше в средней части. Наконец, идёт пи-спираль, например, поверх альфа-спрали и какой-то хитрый узел. Всё это может иметь форму рогатки из двухслойной пи-альфа-спирали на всех трех концах. Может быть и сравнительно  низкочастотной резонансной системой, похожий на U-образный музыкальный камертон. С этим интересно было бы разобраться...



https://img-fotki.yandex.ru/get/896349/158289418.4a5/0_1863ba_ccc834d4_XL.png



Эта структура может быть либо антинаправленными участками альфа-спиралей и двухслойных 310-пи-спиралей, образующих гигантскую трубу, либо рёберным многогранником, в частности 6-угольной пирамидой, основание которой образовано альфа-спиральными участками, а наклонные ребра - двухслойными 310-пи-спиралями. При этом пирамида может быть лишь одним из крайних состояний некого манипулятора, который может развернуться в 6-конечную "звезду". Это нужно моделировать в 3D. Тогда может появиться определенность и ясность.


Две программных спирали в одной белковой цепи

*


Примеры программных спиралей



В этом фрагменте белка присутствуют две программных спирали.



Программная 1111223553355532114135322332-спираль. Период 28 аминокислотных остатков.

https://img-fotki.yandex.ru/get/5411/158289418.42a/0_17b200_1f6190d0_orig.png

Программная 111135332332-спираль. Период 12 аминокислотных остатков.

https://img-fotki.yandex.ru/get/143523/158289418.42a/0_17b1fb_633f86a8_orig.png


https://img-fotki.yandex.ru/get/198786/158289418.42a/0_17b1f6_680c4b41_XL.png





Пикотехнолгия помогла найти ошибки рентгено-структурного анализа

*

*

Высоко периодичные структуры белков


РСА: что мы видим?


Пикотехнологические программные спирали белка



Модель коллагена (программная 335-спираль) -  яркая демонстрация несовершенства рентгеноструктурного анализа. Специалисты по РСА конструируют спираль коллагена из того, что им известно. А известна им альфа-спираль. Вот они и сконструировали модель из 3 альфа-спиралей. Программа Пикотех показывает, что это не тройная, а одинарная, но программная 335-спираль. Радикалы аминокислот действительно располагаются в виде трёх-заходной спирали, что и сбило с толку специалистов по РСА.

Другие программные спирали специалисты по РСА тоже ошибочно интерпретируют известными им "базовыми спиралями", но настало время показать, как устроены реальные, программные спирали белков.

Другими яркими примерами, демонстрирующими несостоятельность РСА, являются  сверхдлинные, в том числе программные спирали.

Наконец, Пикотехнология в отличие от РСА имеет возможность самоповерки. В частности, самоповеркой является 100%-ная корреляция между первичной и вторичной структурой некоторых белков, например, сверхдлинных программных спиралей. Спирали длиной более 1000 витков исключают случайные совпадения, согласитесь. Например, вероятность случайного совпадения композиционных кодов для 310-спирали длиной более 3982 аминокислотных остатков не превышает 4^-3982=2.5*10^-2397, т.е. более двух тысяч нулей после запятой.    


 


https://img-fotki.yandex.ru/get/4000/158289418.421/0_17aaf5_65d3d6c0_orig.gif

Пикотехнология помогла найти ошибки рентгено-структурного анализа

*

*

Формы, механизмы, энергия наномира. Сообщение 91 643

Что такое программа "Пикотехнология белков", и как её грамотно использовать

Пикотехнология помогла найти ошибки рентгеноструктурного анализа

https://img-fotki.yandex.ru/get/4000/158289418.421/0_17aaf5_65d3d6c0_orig.gif

Формы, механизмы, энергия наномира. Сообщение 88 047

Онлайн сервис белковых структур уже функционирует!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

>ENA|ALI34365|complement 1830 nucleotides
ttgagtcttacagaaaaatgtgatatttatgcagctcttcatgatgcaggaattaataga
gtggttaaacatcttatgcaacagcgcccgtctctttttaattttggtacttccttttta
gcatcaaatccaaatctattgtgtgaaaaaattatagctgtgcaagaagtaaacagacaa
cagaatcctcttttaacaatactagaaccaattcctgtcattggtctaccattaagccaa
tctagttcaaacaatttggcaataaattttgcaattcaactttctaaagctgaaatagat
ttccatgaagggaatgtatttcctttaccttcagaacttgtcccattggcaaatcaacgt
ttggctactcatttcaaagtttgtgccggcttggattgtctcggggacttgcctgttctt
agaaggcctccaaataccagaccgtctacttccaaactagaatgtttttgtctagatttg
tatgctataggtggatgcaaaatctctggattagcagaaaaccaaaaaatagggctcaaa
attgatgggatagagatagtggatttaaaaccccaaggattggaaaatgcaatcgaatgt
tatgcaaaatctgtacttaatcatggaatttttccccatgttgctgagattatttccaaa
ttgacatttgggataattactattcctccatccaatggtaacttccaagtatcaggaaat
ttgcagctttcaggaactacgaccgttcctagtaatcctgcaatcgaagatgatcaatta
aaaacatttatcaatttagacaatttggacttggatatcgtattctcaccaaatggtggc
ggtagtggcggtagtggcggtagtggcggcagtggcggcagtggcggtagtggcggcagt
ggaacaataacaagaacagtgaggccgcgatcaagaacaggcacctttgatctaaccgct
gctatatccgaaactacatttaaaaaaatatatggtgcccttcttgaaggatttaaattt
tcagtatcagacacgggcggctctggtatattctcagtaggttatacagtttcggctcat
ttagagaatggcacaatcgatctgcggaataatggttctattctaataagtgaattagac
gtgaaatgggacacattgcagcttaacataggcatagatattccaacacaaactattggt
ggcttttgcctcgttccaaatccatttggtggatgtttgattcgtgctccgtcaattgat
ctttttgaagcatcacctgatatttctttacccttgaacttgggtggactaataacatct
gaaattactttgagtgtaattccaaaggtgttttatggagttggctctggaattccaaac
agatggcaacttaccttagtccctacgcttccaatcgacttggatataattgacgtagca
gacacaattggagatttatttcataatctgattacaaatgcaattgtcagtcttcttagt
tctttgggactccctgattgggctatatcttttatagataccgtgcttggtggaatagaa
ggaataatccgaaacattctagatattggagacgatgtgggtgaatttattttaagtttg
attagtaatgttggtctattccaggatttgattgataagctggctcaattcatagcgctt
acgattctggaactcaaggatcccttggaagttcttgagggaaattctgccataccttta
attccagtaaagttaccaattgaatttttggatgttcggatcgatggtaatggtaatgag
ttgatccttgaaggggatgtgggtaattag

Результат:

https://img-fotki.yandex.ru/get/6109/158289418.423/0_17abfe_d7a43aa6_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/97884/1 … 0_orig.png

https://img-fotki.yandex.ru/get/196102/158289418.423/0_17abff_1e4e2a21_orig.png
В исследуемом белке обнаружен переход программной 335-спирали, характерной для коллагена первого типа в программную 553-спираль, которые строятся под музыку с размером 3/8 (в темпе вальса, точнее в темпе коллагена). Далее программная спираль переходит в бета-спираль длиной 4 аминокислотных остатка.

Кушелев: Модель коллагена (программная 335-спираль) очень яркая демонстрация несовершенства рентгеноструктурного анализа. Специалисты по РСА конструируют спираль коллагена из того, что им известно. А известна им альфа-спираль. Вот они и сконструировали модель из 3 альфа-спиралей. Программа Пикотех показывает, что это не тройная, а одинарная, но программная 335-спираль. Радикалы аминокислот действительно располагаются в виде трёх-заходной спирали, что и сбило с толку специалистов по РСА.

Другие программные спирали специалисты по РСА тоже ошибочно интерпретируют известными им "базовыми спиралями", но настало время показать, как устроены реальные, программные спирали белков. Некоторые из них имеют очень необычные параметры. Такова, например, программная 35-спираль:

https://img-fotki.yandex.ru/get/198860/158289418.3e0/0_176329_6d9df850_L.gif
Подробнее: http://nanoworld.org.ru/topic/1699/

Другими яркими примерами, демонстрирующими несостоятельность РСА, являются сверхдлинные в т.ч. программные спирали/


Наконец, Пикотехнология в отличие от РСА имеет возможность самоповерки. В частности, самоповеркой является 100%-ная корреляция между первичной и вторичной структурой некоторых белков, например, сверхдлинных программных спиралей. Спирали длиной более 1000 витков исключают случайные совпадения, согласитесь. Например, вероятность случайного совпадения композиционных кодов для 310-спирали длиной более 3982 аминокислотных остатков не превышает 4^-3982=2.5*10^-2397, т.е. более двух тысяч нулей после запятой  Подробнее об этом белке можно прочесть здесь: http://nanoworld.org.ru/topic/1656/page/5/




    Victoriy пишет:

    где РСА о том, что на участке из 17 а.о. в АПФ (белок от diprospan) действительно 3/10 спираль

    Кушелев: А тут дело уже не в РСА, а в ничтожной вероятности повторения одинаковых кодов "4", "1", "3" и "2".

    Если бы коды "1" и "4" были бы равнозначными, то почему встречаются длинные последовательности 1111111111 и 444444444444 ? По-Вашей гипотезе это бессмысленно.

    По моей это прямые альфа- и 310-спирали соответственно.



      Формы, механизмы, энергия наномира. Сообщение 83 395

      https://img-fotki.yandex.ru/get/195771/158289418.3a9/0_16e45e_5079e0c_orig.png

      Кушелев: Вероятность случайного расположения 17 одинаковых кодов = 0.25^-17 = 5.8*10^-11






      Вероятность случайного расположения 22 звеньев цикла = 0.25^-22 = 5.7*10^-14








      https://img-fotki.yandex.ru/get/176331/158289418.3a9/0_16e469_468e8c12_orig.png

      Вероятность случайного расположения 22 одинаковых кодов = 0.25^-22 = 5.7*10^-14





      http://www.rcsb.org/pdb/explore/explore … ureId=4BT9

      http://www.uniprot.org/uniprot/P13674

      http://www.ebi.ac.uk/ena/data/view/AAA36534

      http://www.ebi.ac.uk/ena/data/view/AAA3 … play=fasta


      >ENA|AAA36534|AAA36534.1 Homo sapiens (human) hypothetical protein 
      ATGATCTGGTATATATTAATTATAGGAATTCTGCTTCCCCAGTCTTTGGCTCATCCAGGC
      TTTTTTACTTCAATTGGTCAGATGACTGATTTGATCCATACTGAGAAAGATCTGGTGACT
      TCTCTGAAAGATTATATTAAGGCAGAAGAGGACAAGTTAGAACAAATAAAAAAATGGGCA
      GAGAAGTTAGATCGGCTAACTAGTACAGCGACAAAAGATCCAGAAGGATTTGTTGGGCAT
      CCAGTAAATGCATTCAAATTAATGAAACGTCTGAATACTGAGTGGAGTGAGTTGGAGAAT
      CTGGTCCTTAAGGATATGTCAGATGGCTTTATCTCTAACCTAACCATTCAGAGACCAGTA
      CTTTCTAATGATGAAGATCAGGTTGGGGCAGCCAAAGCTCTGTTACGTCTCCAGGATACC
      TACAATTTGGATACAGATACCATCTCAAAGGGTAATCTTCCAGGAGTGAAACACAAATCT
      TTTCTAACGGCTGAGGACTGCTTTGAGTTGGGCAAAGTGGCCTATACAGAAGCAGATTAT
      TACCATACGGAACTGTGGATGGAACAAGCCCTAAGGCAACTGGATGAAGGCGAGATTTCT
      ACCATAGATAAAGTCTCTGTTCTAGATTATTTGAGCTATGCGGTATATCAGCAGGGAGAC
      CTGGATAAGGCACTTTTGCTCACAAAGAAGCTTCTTGAACTAGATCCTGAACATCAGAGA
      GCTAATGGTAACTTAAAATATTTTGAGTATATAATGGCTAAAGAAAAAGATGTCAATAAG
      TCTGCTTCAGATGACCAATCTGATCAGAAAACTACACCAAAGAAAAAAGGGGTTGCTGTG
      GATTACCTGCCAGAGAGACAGAAGTACGAAATGCTGTGCCGTGGGGAGGGTATCAAAATG
      ACCCCTCGGAGACAGAAAAAACTCTTTTGCCGCTACCATGATGGAAACCGTAATCCTAAA
      TTTATTCTGGCTCCAGCTAAACAGGAGGATGAATGGGACAAGCCTCGTATTATTCGCTTC
      CATGATATTATTTCTGATGCAGAAATTGAAATCGTCAAAGACCTAGCAAAACCAAGGCTG
      AGCCGAGCTACAGTACATGACCCTGAGACTGGAAAATTGACCACAGCACAGTACAGAGTA
      TCTAAGAGTGCCTGGCTCTCTGGCTATGAAAATCCTGTGGTGTCTCGAATTAATATGAGA
      ATACAAGATCTAACAGGACTAGATGTTTCCACAGCAGAGGAATTACAGGTAGCAAATTAT
      GGAGTTGGAGGACAGTATGAACCCCATTTTGACTTTGCACGGAAAGATGAGCCAGATGCT
      TTCAAAGAGCTGGGGACAGGAAATAGAATTGCTACATGGCTGTTTTATATGAGTGATGTG
      TCTGCAGGAGGAGCCACTGTTTTTCCTGAAGTTGGAGCTAGTGTTTGGCCCAAAAAAGGA
      ACTGCTGTTTTCTGGTATAATCTGTTTGCCAGTGGAGAAGGAGATTATAGTACACGGCAT
      GCAGCCTGTCCAGTGCTAGTTGGCAACAAATGGGTATCCAATAAATGGCTCCATGAACGT
      GGACAAGAATTTCGAAGACCTTGTACGTTGTCAGAATTGGAATGA


      https://img-fotki.yandex.ru/get/100269/158289418.3a9/0_16e46a_42bf249f_orig.png


      Много обещающая альфа-спираль с 21 по 71!!!

      А что нам покажет программа Пикотех?

      https://img-fotki.yandex.ru/get/194503/ … 6_orig.gif

      Такова однако точность РСА...

      https://img-fotki.yandex.ru/get/3505/158289418.3a9/0_16e46d_b82fdb29_orig.png
      Эта периодическая структура может оказаться ...  научным прорывом. Но это мы проверим уже завтра...





        Формы, механизмы, энергия наномира. Сообщение 83 417

        Victoriy пишет:

        Похоже я открыла ящик Пандоры, научив А.Ю. пользоваться PDB . 
        Уважаемый Александр Юрьевич, давайте вместе проанализируем Ваш материал по кодированию различных видов спиралей на основе экспериментально показанных спиральных участков в белках 1TAG; 3SDH; 1GPB; 1PZ4; 1OBO; 1GS6; 1H1N; 1LRV и АПФ от Дипроспана. Структура последнего энзима мне лично не безразлично, т.к. его активность в сыворотке крови пациентов с лакунарными инсультами я определяла в этом году в одной из текущих НИР.
        Предлагаю в скайпе голосом, а потом Вы выложите свой материал на форуме.

        На форум интересно текст выложить, а не голос  Давайте сначала разберёмся с самоповеркой пикотехнологии

        Согласитесь, что таких случайностей просто не бывает 

        Кстати, эта тема имеет продолжение

        Итак, вопрос для богини пикотехнологии, Виктории Соколик:

        "Вы согласны, что структуры альфа-спирали, 310-спирали, фрагмента лизоцима из этой темы однозначно подтверждают:

        1. Кодирование прямой альфа-спирали кодами -1111111111111111111111-
        2. Кодирование прямой 310-спирали кодами -444444444444-
        3. Программирование цикла из 22 аминокислотных остатков лизоцима" ?

        Если есть возражения, то жду Ваших аргументов. Пока мы не придём к консенсусу по данному вопросу, более сложные вопросы, как то нюансы статистики, я обсуждать не готов.




          Формы, механизмы, энергия наномира. Сообщение 83 415

          http://www.rcsb.org/pdb/explore/explore … ureId=5KYN

          https://img-fotki.yandex.ru/get/169608/158289418.3aa/0_16e49f_d788664d_XL.png

          http://www.uniprot.org/uniprot/Q15436

          http://www.ebi.ac.uk/ena/data/view/CAA65774

          https://img-fotki.yandex.ru/get/50623/1 … 8_orig.gif

          Как видим, данные РСА опять не соответствуют даже типу белка. Указаны десятки протяженных альфа-спиралей, а в структуре белка их нет 


          https://img-fotki.yandex.ru/get/70180/158289418.3aa/0_16e4a1_e241f524_orig.png
          Очень любопытный тип программной спирали



          [21:56:06] Кушелев Александр Юрьевич: Я сейчас пишу о прямой альфа-спирали, состоящей из 22 аминокислотных остатков
          [21:56:21] Кушелев Александр Юрьевич:

          https://img-fotki.yandex.ru/get/176331/158289418.3a9/0_16e469_468e8c12_L.png

          [21:58:49] Кушелев Александр Юрьевич: Вероятность случайного образования прямой альфа-спирали из 22 ао = как 44 раза монетка упадёт на "орла"
          [21:59:14] Кушелев Александр Юрьевич: Если Вы думаете, что это вероятно, попробуйте 



            Формы, механизмы, энергия наномира. Сообщение 83 439

            Skype:

            [28.11.2016 20:25:50] *** Кушелев Александр Юрьевич отправил контактные данные каштан. ***
            [16:42:43] каштан: у вас на этой картинке

            http://img-fotki.yandex.ru/get/9229/158289418.af/0_ae26a_4c84e562_S.gif
            что изображено ?
            [17:36:39] Кушелев Александр Юрьевич: Кольцегранная и упрощённая (многогранная) динамическая модель аминокислоты
            [17:37:48] каштан: пять атомов ?
            [17:37:51] Кушелев Александр Юрьевич: Да. Это глицин
            [17:38:10] каштан: какие пять атомов ?
            [17:40:57] каштан: https://ru.wikipedia.org/wiki/%D0%93%D0 … 0%B8%D0%BD
            здесь написано про шесть атомов
            [17:41:02] Кушелев Александр Юрьевич: NCCOO
            [17:41:09] Кушелев Александр Юрьевич: Да, это они
            [17:42:00] каштан: глицин это NHHHOO
            вы что-то другое написали
            [17:42:33] Кушелев Александр Юрьевич: Водород не показан
            [17:42:45] Кушелев Александр Юрьевич: Только атомы углерода, азота и кислорода
            [17:43:01] Кушелев Александр Юрьевич: NCCOO
            [17:44:45] каштан: почему атомы одинаковых размеров ?
            [17:45:43] Кушелев Александр Юрьевич: Потому что разных
            [17:45:47] Кушелев Александр Юрьевич: 
            [17:47:19] каштан: на этой картинке атомы под другому соединяются


            https://img-fotki.yandex.ru/get/94893/158289418.3aa/0_16e614_af415f61_XL.jpg
            [17:48:39] Кушелев Александр Юрьевич: Одни и те же атомы углерода могут соединиться в алмаз и графит
            [17:49:06] каштан: в смысле вкладываются друг в друга
            [17:50:35] Кушелев Александр Юрьевич: Нет
            [17:50:50] каштан: кислород в полтора раза больше углерода - на вашей картинке этого не видно
            [17:52:16] Кушелев Александр Юрьевич: Углерод может иметь разный размер в зависимости от условий. Он может быть многогранным и сопряжённым
            [17:55:02] каштан: вы говорите о группе атомов
            сами атомы одного элемента одинаковые с незначительными отличиями по изотопам
            ещё раз
            атом углерода в полтора раза меньше атома кислорода
            [17:55:29] каштан: соколик вам об этом говорила
            [17:55:37] Кушелев Александр Юрьевич: Один и тот же атом углерода может иметь разные размеры и форму
            [18:04:37] каштан: ATG - это метионин ?
            https://en.wikipedia.org/wiki/Methionine
            в состав которого входит сера ?
            [18:05:27] Кушелев Александр Юрьевич: Да
            [18:05:57] каштан: атом серы в три раза больше атома углерода
            [18:06:30] каштан: и в два раза больше кислорода с азотом
            [18:06:42] Кушелев Александр Юрьевич: И так бывает
            [18:07:03] каштан: в вашей модели все атомы одинаковые ?
            [18:07:57] Кушелев Александр Юрьевич: Нет. Даже один атом углерода может иметь сильно разные размеры. Я уже писал выше
            [18:09:23] каштан: атом углерода может иметь размеры атома серы и в результате программа строит модель из атомов одинаковых размеров ?
            [18:13:12] Кушелев Александр Юрьевич: Какие же это одинаковые размеры?


            https://img-fotki.yandex.ru/get/174613/158289418.3a5/0_16d603_ed6fe55c_XL.png


            [18:14:11] Кушелев Александр Юрьевич:


            http://img-fotki.yandex.ru/get/6305/126580004.56/0_bd389_21b12eb4_S.gif
            [18:15:25] Кушелев Александр Юрьевич: Зеленые и красные могут быть атомами углерода (+водород)
            [18:20:45] каштан: в этой модели

            http://img-fotki.yandex.ru/get/5414/126580004.3d/0_b0f20_2c87f90a_orig.gif
            все атомы выглядят одинаковыми
            соколик говорила о том что ваша программа не учитывает межатомные расстояния (размеры атомов)
            найти это сообщение не представляется возможным потому что у вас на форуме нет поиска
            [18:22:08] Кушелев Александр Юрьевич: Во-первых, на форуме поиск есть, но для зарегистрированных пользователей.
            [18:22:34] Кушелев Александр Юрьевич: Во-вторых, я Вам уже показал, что даже один атом углерода может иметь разные размеры. Причём сильно разные.
            [18:24:36] Кушелев Александр Юрьевич: Виктория говорит о том, что в моей программе не учтены изменения радиусов внешних электронов. Это действительно так. Но радиусы колец-электронов, например, для ионов кислорода, хлора и фтора отличаются меньше, чем на процент. У Виктории размеры электронов/граней отличаются на порядок больше, т.е. ошибочно. Поэтому моя программа хоть и упрощённая, но раз в 10 точнее 
            [18:27:51] Кушелев Александр Юрьевич: Но это только по радиусам электронов. Если говорить о вторичной структуре, то тут уже различие в точности принципиальное. Ведь у Виктории по кодам "1" и "4" строится прямая спираль с шагом 3 аминокислотных остатка на виток. А большинство спиральных участков имеет 3.6 аминокислотных остатка на виток. При этом фазовый набег приводит к тому, что спиральные участки у Виктории повёрнуты не на те углы, поэтому все модели белков "в раскоряку" 


            Кушелев на CASP - неудобный конкурс, неудобный конкурсант
            https://nano-world-articles.nethouse.ru/articles/313527
            Подборка материалов



            Victoriy пишет:

            Виктория слегка подпортила таблицу;

            Кушелев: Тут два варианта. Либо Виктория слегка подпортила таблицу, либо Виктория легко кинет монетку на "орла" 44 раза подряд 



            Victoriy пишет:

            У Виктории размеры электронов/граней отличаются на порядок больше, т.е. ошибочно.

            Кушелев: Сначала я определил радиусы кольцевых электронов из рефрактометрических радиусов ионов кислорода, хлора и фтора (Работа Гольдшмидта 1923г). Для ионов кислорода, хлора и фтора отличие радиусов электронов не превышало 1%. Позднее радиусы электронов удалось уточнить масштабированием белковых молекул. Ведь макромолекулы белка могут иметь гигантские размеры в масштабах микромира. Я подобрал размер кольцевого электрона таким образом, чтобы размеры белковых молекул, определённых экспериментально совпали с кольцегранными моделями в программе PiMol и HyperChem.
            Совпадение размеров макромолекул получилось при диаметре кольца-электрона 1.7А.



            Действительно, атом серы в том же метионине 

            или цистеине существенно больше атома углерода, там внешние электроны раздвинуты предвнешней оболочкой, но это - радикал, который не влияет на параметры белковой "цепи". Ведь параметры белковой "цепи" определяются геометрией пептидной группы. Согласны?



            Открыт новый тип белковой структуры - метиониновая спираль

            *

            *



              Пикотехнология белков, ДНК, РНК - 2

              http://www.myshared.ru/slide/643151/

              Цитата: 15  МЕТИОНИН - незаменимая АМК. Необходима для синтеза белков, участвует в реакциях дезаминирования, является источником серы для синтеза цистеина. Метионил-тРНК участвует в инициации трансляции. Метильная группа метионина - мобильный одноуглеродный фрагмент, используемый для синтеза ряда соединений в реакциях переноса этой группы на соответствующий акцептор (реакция транс- метилирования) Метильная группа в молекуле метионина прочно связана с атомом S, поэтому непосредственным донором этого одноуглеродного фрагмента служит активная форма метионина - S-аденозилметионин (SAM) 
              16  S-аденозилметионин (SAM) - сульфониевая форма метионина, образующаяся при его присоединении к молекуле аденозина (продукта гидролиза АТФ) Реакция активации метионина Присутствует во всех типах клеток Структура (S + -CH 3 ) в SAM - нестабильная группировка, определяющая высокую активность метильной группы (отсюда термин «активный метионин»). Это уникальная реакция, единственная, в результате которой освобождаются все три фосфатных остатка АТФ. Отщепление метильной группы от SAM и перенос ее на соединение -акцептор катализируют метилтрансферазы в реакциях транс- метилирования. SAM в ходе реакции превращается в S-аденозилгомоцистеин (SAГ). 
              Конец цитаты.

              Кушелев: Понятно. Связь Met-Cys косвенно подтверждается, т.к. Cys образуется из Met, а значит, что в мышином лизоциме тоже возможно превращение Met в Cys в процессе дозревания белка.

              https://img-fotki.yandex.ru/get/196070/158289418.3c3/0_17074a_a85f2577_XL.gif



              Открыт новый тип белковой структуры!

              http://nanoworld.org.ru/post/82432/#p82432

              >NM_207361.5 Homo sapiens FRAS1 related extracellular matrix protein 2 (FREM2), mRNA
              GGGATTTCCCTCAAAGCCCAGGGTCCGGGGACCTGGAAAGTAGAAGTGGAGGGATTCAATTCTCCGCGCG
              ATTGAGGCGCTAGCGGCGGAGCTGGACGGCCTGGGAAGGCTTCGGCTCCTCGGCTGCGGCTCCAGCCCGG
              ACGGCGCCGCGCAACTTTGCCATCCTTCTGGCCCAGCCCCGGCTACAGGAGGACCCCGCGGGCAACGCGC
              GGAGTTCCTGGCACTTCCCGGCGGTGTCTCTTGTTGTCTGCCCGGGGACCGACTTCGCATGCTCTCAGGC
              TGACCTGTCCAAGCCCGAACACCGGGACCATGCACTCAGCCGGGACTCCCGGGTTATCCTCGCGCCGGAC
              AGGCAACTCCACCAGCTTTCAACCAGGACCGCCACCGCCGCCCCGGCTGCTGCTGCTGCTGCTGCTTCTC
              CTGTCACTGGTAAGCCGCGTCCCGGCACAGCCCGCTGCCTTCGGCAGGGCGTTGCTGTCCCCTGGTCTCG
              CGGGGGCTGCAGGGGTCCCTGCTGAGGAGGCCATAGTGCTGGCGAACCGCGGACTCCGGGTGCCTTTCGG
              CCGTGAAGTCTGGCTGGATCCCCTGCATGACCTGGTGTTGCAGGTGCAGCCCGGGGACCGCTGCGCGGTT
              TCGGTACTAGACAACGACGCACTGGCCCAGCGACCGGGCCGCCTGAGTCCCAAGCGCTTCCCGTGCGACT
              TTGGCCCTGGCGAGGTGCGCTACTCTCACCTGGGCGCGCGCAGCCCGTCTCGGGACCGCGTCCGGCTGCA
              GCTGCGCTATGACGCGCCCGGAGGGGCAGTAGTGCTACCACTGGTACTGGAGGTGGAGGTGGTCTTCACC
              CAGCTGGAGGTTGTGACTCGGAACTTGCCTCTGGTCGTGGAAGAGCTGCTGGGGACCAGCAATGCCCTGG
              ACGCGCGGAGCCTGGAGTTCGCCTTCCAGCCCGAGACAGAGGAGTGCCGCGTGGGCATCCTGTCCGGCTT
              GGGCGCGCTGCCTCGCTATGGAGAACTCCTCCACTACCCGCAGGTCCCTGGAGGAGCCAGAGAGGGAGGC
              GCCCCGGAGACTCTCCTGATGGACTGCAAAGCTTTCCAGGAACTAGGCGTGCGCTATCGCCACACAGCCG
              CCAGTCGCTCACCAAACAGGGACTGGATACCCATGGTGGTGGAGCTGCGTTCACGAGGGGCTCCTGTGGG
              CAGCCCTGCTTTGAAACGCGAGCACTTCCAGGTTCTGGTGAGGATCCGAGGAGGGGCCGAGAACACTGCA
              CCCAAGCCCAGTTTCGTGGCCATGATGATGATGGAGGTGGACCAGTTTGTACTGACGGCCCTGACCCCAG
              ACATGCTGGCAGCCGAGGATGCTGAGTCTCCCTCTGACCTGTTGATCTTCAACCTTACTTCTCCATTCCA
              GCCTGGCCAGGGCTACTTGGTGAGCACCGATGATCGCAGCCTGCCCCTTTCCTCCTTCACTCAGAGGGAT
              CTGCGGCTCCTGAAGATTGCCTACCAGCCCCCTTCTGAAGACTCTGACCAGGAGCGCCTCTTTGAACTGG
              AATTGGAGGTAGTGGATCTAGAAGGAGCAGCTTCAGACCCTTTTGCCTTCATGGTAGTGGTGAAGCCCAT
              GAACACAATGGCTCCGGTGGTCACCCGGAATACCGGTCTTATTCTCTATGAGGGTCAGTCTCGGCCCCTC
              ACAGGCCCTGCAGGCAGTGGTCCGCAAAACTTGGTCATCAGCGATGAGGATGACCTAGAAGCAGTGCGGC
              TAGAGGTGGTGGCTGGGCTCCGGCATGGTCACCTTGTCATTCTGGGTGCTTCCAGTGGCAGCTCTGCTCC
              CAAGAGCTTTACAGTGGCTGAGCTGGCAGCCGGCCAGGTGGTCTACCAGCATGATGACAGAGACGGCTCG
              CTGAGCGACAACCTGGTGCTTCGCATGGTGGATGGAGGAGGCAGGCACCAGGTACAGTTTCTGTTCCCCA
              TCACCTTAGTGCCTGTGGATGACCAGCCACCTGTTCTCAATGCCAACACGGGGCTGACACTGGCAGAGGG
              TGAAACAGTGCCCATCCTGCCCCTTTCCCTGAGTGCAACTGACATGGATTCAGATGATTCTCTGCTGCTT
              TTTGTGCTGGAGTCACCCTTCTTAACTACGGGGCATCTGCTTCTCCGCCAAACTCACCCTCCCCATGAGA
              AGCAGGAACTTCTCAGAGGCCTTTGGAGGAAGGAGGGGGCATTTTATGAGCGAACAGTGACAGAGTGGCA
              GCAGCAGGACATAACAGAGGGCAGGCTGTTCTATAGACACTCTGGGCCCCATAGTCCTGGGCCAGTCACA
              GACCAGTTCACATTTAGAGTCCAGGATAACCATGACCCTCCTAATCAGTCCGGGCTACAGCGGTTTGTGA
              TTCGTATCCATCCTGTGGATCGCCTCCCTCCGGAGCTGGGCAGTGGCTGTCCCCTTCGTATGGTGGTACA
              GGAATCCCAGCTCACACCACTGAGGAAGAAGTGGCTGCGCTACACTGACCTGGACACAGATGACCGAGAA
              CTACGTTACACAGTGACTCAGCCCCCCACAGACACAGACGAAAATCACCTGCCAGCCCCACTGGGTACCT
              TGGTCTTGACTGACAACCCCTCAGTCGTGGTGACCCATTTTACCCAAGCCCAGATCAACCATCATAAAAT
              TGCTTACAGACCCCCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTTCCAGTTCCAGGTGGAA
              GACCGAGCTGGGAATGTGGCTCCAGGTACCTTTACCCTTTACTTGCATCCCGTGGACAACCAGCCACCTG
              AGATCCTCAACACCGGCTTCACTATTCAGGAGAAGGGTCACCACATCCTGAGTGAGACAGAGTTGCACGT
              GAATGATGTAGACACTGATGTTGCCCATATCTCTTTCACTCTCACTCAGGCACCCAAACATGGCCACATG
              AGAGTGTCTGGACAGATCCTGCATGTAGGGGGTCTCTTCCACTTGGAGGACATAAAACAGGGCCGAGTTT
              CCTATGCCCATAATGGGGACAAGTCCCTGACTGATAGCTGCTCCTTGGAAGTCAGTGACAGACATCATGT
              GGTGCCCATCACTCTCAGAGTAAATGTCCGGCCAGTGGATGATGAAGTGCCCATACTGAGCCATCCTACT
              GGCACTCTGGAGTCCTATCTAGATGTCTTAGAAAATGGGGCTACTGAAATCACTGCCAATGTTATTAAGG
              GGACCAATGAGGAAACTGATGACTTGATGTTGACTTTCCTCTTGGAAGATCCACCTTTGTATGGGGAAAT
              CTTGGTCAATGGCATTCCAGCAGAGCAGTTTACTCAAAGGGACATCTTGGAGGGCTCTGTTGTATATACC
              CACACCAGTGGTGAGATAGGCCTATTGCCTAAAGCGGATTCTTTTAACCTGAGTCTGTCAGATATGTCTC
              AAGAATGGAGAATTGGTGGCAATACTATCCAAGGAGTTACTATATGGGTGACCATCCTGCCTGTTGATAG
              CCAGGCCCCAGAAATCTTTGTAGGTGAACAGTTGATAGTAATGGAAGGTGATAAAAGTGTTATAACATCA
              GTGCATATAAGTGCTGAAGATGTCGACTCCCTGAATGATGACATCTTGTGCACTATAGTTATTCAGCCTA
              CTTCAGGTTATGTTGAAAACATTTCTCCAGCACCAGGCTCTGAGAAATCAAGAGCAGGGATTGCCATAAG
              TGCTTTCAACTTGAAAGATCTCAGGCAGGGCCACATAAACTATGTCCAGAGTGTCCATAAAGGGGTGGAA
              CCTGTGGAGGACCGATTTGTATTTCGTTGTTCTGATGGCATTAACTTTTCAGAGAGACAGTTCTTCCCCA
              TTGTAATCATTCCCACCAATGATGAACAGCCAGAGATGTTTATGAGAGAATTTATGGTGATGGAAGGCAT
              GAGTCTGGTAATTGATACACCCATTCTCAATGCTGCTGATGCTGATGTTCCCCTGGATGATTTAACTTTC
              ACTATTACCCAATTCCCCACTCATGGTCACATCATGAATCAGCTGATAAATGGCACGGTTTTGGTCGAAA
              GCTTCACCTTGGATCAGATCATAGAGAGTTCCAGCATTATTTATGAGCATGATGACTCCGAGACCCAGGA
              AGACAGTTTTGTGATTAAACTAACAGATGGGAAGCACTCTGTGGAAAAGACGGTCCTCATTATAGTTATC
              CCTGTTGATGATGAGACGCCCAGAATGACTATCAATAATGGACTAGAAATAGAAATTGGGGATACCAAGA
              TTATCAACAACAAAATATTAATGGCAACAGATTTAGATTCAGAAGACAAATCTTTGGTTTATATTATTCG
              TTATGGGCCAGGACATGGCTTATTACAGAGACGAAAACCTACTGGTGCCTTTGAAAATATCACACTGGGC
              ATGAATTTTACCCAGGATGAAGTAGACAGAAACTTAATTCAGTATGTCCATTTGGGGCAAGAGGGCATTC
              GGGACCTAATTAAATTTGATGTGACTGATGGAATAAATCCCCTCATAGATCGTTACTTTTATGTGTCCAT
              CGGGAGCATTGACATTGTCTTCCCTGATGTGATAAGTAAGGGAGTGTCCTTGAAAGAAGGTGGCAAAGTC
              ACTCTTACAACAGACCTACTAAGCACTAGTGACTTGAACAGTCCTGATGAAAACTTGGTTTTTACCATCA
              CCAGGGCTCCCATGCGAGGTCACCTGGAATGCACGGATCAGCCTGGTGTGTCCATCACGTCTTTCACTCA
              GCTGCAACTGGCTGGAAACAAAATCTACTACATCCACACAGCTGATGATGAAGTGAAAATGGACAGTTTT
              GAGTTTCAAGTCACCGATGGACGTAACCCTGTCTTTCGGACATTCCGTATCTCCATTAGCGATGTGGACA
              ATAAAAAGCCAGTGGTCACCATCCACAAGCTGGTTGTCAGTGAAAGTGAAAACAAGCTGATTACTCCTTT
              TGAGCTCACTGTCGAAGACAGAGATACTCCTGACAAGCTCCTGAAATTCACTATCACCCAGGTGCCTATT
              CATGGCCATCTCCTATTCAACAATACCAGACCTGTCATGGTTTTTACCAAGCAAGACTTGAATGAAAACT
              TAATCAGCTACAAACATGATGGCACTGAGTCAAGTGAAGATAGCTTCTCCTTCACAGTGACTGATGGCAC
              CCATACAGACTTCTATGTTTTTCCTGATACGGTGTTTGAAACAAGGAGACCCCAAGTGATGAAGATCCAG
              GTCTTGGCTGTTGACAACAGTGTCCCCCAAATCGCAGTGAATAAGGGGGCCTCTACACTTCGCACTCTAG
              CCACTGGCCACTTGGGGTTCATGATCACAAGCAAAATATTGAAAGTGGAGGACAGAGACAGCTTACACAT
              TTCTCTTAGATTTATCGTGACAGAGGCCCCTCAACATGGATATCTTCTCAACCTGGACAAAGGCAACCAC
              AGCATCACTCAGTTCACACAAGCTGACATTGATGACATGAAAATATGCTATGTCTTAAGAGAAGGGGCTA
              ATGCCACAAGTGATATGTTCTATTTTGCAGTTGAAGATGGTGGTGGAAACAAGTTAACGTACCAGAATTT
              TCGTCTGAATTGGGCATGGATCTCCTTTGAAAAGGAATATTACCTGGTCAATGAGGACTCCAAATTTCTA
              GATGTTGTTCTTAAACGTAGAGGTTACTTGGGAGAAACTTCTTTTATAAGTATTGGCACAAGAGACAGAA
              CTGCAGAAAAAGACAAAGACTTCAAGGGCAAAGCACAGAAACAAGTGCAGTTCAACCCAGGCCAGACCAG
              GGCCACATGGCGAGTGCGGATCCTGAGTGATGGGGAGCATGAGCAGTCTGAAACCTTTCAGGTGGTACTC
              TCAGAGCCCGTGCTGGCTGCCTTGGAATTCCCCACAGTCGCCACTGTTGAGATCGTTGATCCAGGAGATG
              AGCCAACTGTGTTTATTCCCCAGTCCAAATACTCCGTTGAAGAAGATGTTGGTGAGCTGTTCATTCCCAT
              CAGGAGGAGCGGAGATGTGAGCCAGGAGTTGATGGTGGTCTGTTATACCCAACAAGGAACAGCAACTGGA
              ACTGTGCCGACTTCCGTGTTGTCTTACTCTGATTACATATCCAGGCCTGAGGACCACACCAGTGTTGTCC
              GCTTTGACAAAGATGAACGGGAGAAACTGTGTCGGATAGTCATAATTGATGACTCTTTGTACGAGGAGGA
              GGAAACCTTCCATGTCCTTCTGAGCATGCCCATGGGGGGAAGAATCGGATCAGAGTTCCCAGGGGCTCAA
              GTTACAATCGTTCCTGACAAAGATGATGAACCCATCTTTTACTTCGGTGATGTGGAATACTCTGTGGATG
              AGAGTGCTGGCTATGTGGAAGTGCAGGTGTGGAGAACGGGCACTGACCTGTCCAAGTCTTCTAGTGTCAC
              AGTGAGGTCTCGGAAAACAGATCCTCCCTCTGCAGATGCTGGAACAGACTATGTGGGCATCAGCCGTAAT
              TTAGATTTTGCACCTGGAGTCAACATGCAGCCTGTTCGTGTTGTCATTCTGGATGACCTTGGACAACCAG
              CGCTGGAGGGAATTGAGAAATTTGAACTGGTGCTTCGCATGCCTATGAACGCAGCCCTTGGCGAGCCCAG
              CAAAGCCACAGTGTCCATAAATGACTCTGTCTCCGATTTGCCTAAGATGCAATTCAAAGAACGAATATAT
              ACTGGCAGCGAAAGTGATGGGCAGATAGTTACAATGATCCATAGGACTGGGGATGTCCAGTACAGATCTT
              CAGTGAGATGCTACACCCGGCAGGGGTCTGCACAGGTGATGATGGACTTTGAAGAACGCCCAAACACTGA
              TACCTCCATCATCACATTCCTCCCTGGTGAGACAGAAAAGCCCTGCATTCTTGAGCTGATGGACGATGTG
              CTCTATGAGGAGGTAGAGGAGCTCCGCCTGGTACTCGGCACTCCACAAAGCAACTCTCCCTTTGGGGCTG
              CAGTTGGTGAACAAAATGAAACTCTCATAAGGATCCGAGATGATGCTGATAAGACTGTTATTAAATTTGG
              AGAAACCAAATTTAGTGTCACTGAACCCAAAGAACCTGGAGAGTCGGTGGTTATAAGAATTCCAGTGATT
              CGCCAAGGAGACACTTCAAAGGTTTCCATTGTGAGAGTCCACACCAAGGATGGCTCGGCCACCTCTGGAG
              AAGACTACCACCCTGTGTCAGAAGAAATTGAGTTTAAGGAAGGGGAAACCCAGCACGTGGTTGAAATCGA
              AGTTACCTTTGACGGGGTGAGAGAGATGAGAGAGGCCTTCACTGTTCACCTAAAACCTGATGAAAATATG
              ATAGCAGAGATGCAGTTGACGAAAGCCATTGTGTACATAGAAGAAATGAGCAGCATGGCAGATGTCACTT
              TTCCTTCTGTCCCTCAAATTGTATCCCTGTTGATGTATGACGACACTTCCAAAGCTAAGGAGAGTGCTGA
              ACCCATGTCTGGCTATCCTGTCATCTGTATCACAGCTTGCAACCCCAAATATTCAGACTACGATAAAACA
              GGCTCTATCTGTGCAAGTGAGAACATCAATGACACTTTGACGCGGTACCGGTGGCTGATTAGTGCACCTG
              CGGGCCCTGACGGTGTGACCAGCCCTATGAGAGAAGTGGACTTCGACACCTTTTTTACGTCATCCAAGAT
              GGTCACACTGGACTCCATATACTTTCAGCCTGGCTCCCGGGTACAGTGCGCAGCTCGTGCTGTGAACACC
              AATGGGGATGAAGGCCTGGAGCTCATGAGCCCTATTGTAACCATCAGCAGAGAAGAAGGTCTTTGTCAGC
              CCCGTGTACCTGGGGTTGTTGGAGCAGAGCCGTTCTCAGCTAAATTGCGCTACACAGGCCCTGAGGATGC
              AGACTACACAAACCTTATCAAGCTCACTGTCACAATGCCACACATAGATGGCATGCTCCCCGTGATCTCC
              ACTAGAGAGCTTTCCAACTTTGAGCTCACCCTCAGCCCTGATGGCACAAGAGTTGGAAACCACAAGTGCT
              CCAACCTCCTGGATTATACTGAAGTGAAGACTCATTATGGTTTCTTGACTGATGCTACCAAAAATCCAGA
              AATAATTGGAGAGACATATCCTTACCAGTACAGCTTGTCCATCAGAGGTTCCACTACCTTGCGCTTCTAC
              CGGAACCTGAACCTAGAGGCCTGTTTATGGGAGTTCGTTAGCTACTATGACATGTCAGAACTCCTTGCTG
              ACTGTGGTGGCACCATTGGAACAGATGGACAGGTCCTAAACCTAGTGCAGTCCTATGTGACCCTTCGAGT
              CCCTCTGTATGTTTCCTACGTGTTCCATTCCCCCGTGGGGGTAGGAGGCTGGCAGCATTTTGACTTGAAG
              TCAGAGCTTCGTCTAACTTTTGTGTACGACACCGCCATCTTGTGGAATGATGGAATTGGCAGCCCCCCAG
              AGGCTGAACTTCAAGGTTCTCTCTATCCAACCAGCATGCGCATCGGTGATGAGGGGCGCTTGGCCGTGCA
              CTTCAAGACAGAGGCTCAGTTCCATGGCTTATTTGTGCTGTCACATCCCGCATCCTTTACAAGCTCAGTG
              ATCATGTCAGCTGATCATCCAGGCCTGACATTTTCCCTCCGCCTCATAAGGAGTGAACCAACCTATAACC
              AGCCAGTACAGCAGTGGAGCTTTGTCTCTGACTTTGCCGTACGTGACTACTCAGGGACCTATACTGTGAA
              GCTGGTGCCATGCACTGCCCCATCACATCAGGAATACCGCCTGCCAGTCACCTGCAACCCCAGAGAACCT
              GTCACCTTTGACCTTGACATCCGATTCCAACAGGTCAGTGATCCAGTGGCTGCTGAGTTTAGCTTGAACA
              CCCAAATGTACCTGCTCTCTAAGAAGAGTCTCTGGTTGTCTGATGGATCCATGGGATTCGGGCAAGAGAG
              TGATGTTGCTTTTGCAGAAGGTGATATAATTTATGGTCGTGTCATGGTGGATCCTGTCCAGAATCTGGGT
              GACTCCTTTTACTGCAGCATTGAGAAGGTGTTTCTATGCACTGGAGCTGATGGCTATGTTCCCAAGTATA
              GTCCAATGAATGCAGAATATGGCTGCTTAGCCGACTCTCCTTCACTCTTATATAGATTTAAAATTGTGGA
              CAAAGCTCAGCCAGAGACACAAGCGACCAGTTTTGGAAATGTCCTATTTAATGCCAAACTAGCAGTGGAT
              GACCCTGAAGCCATTCTCTTAGTGAATCAGCCTGGATCTGATGGATTTAAAGTCGACTCAACACCACTCT
              TTCAGGTCGCTCTAGGCCGAGAATGGTATATACATACGATCTATACAGTGAGATCGAAAGACAATGCCAA
              TCGAGGTATTGGCAAAAGAAGTGTGGAGTACCATTCTCTGGTGAGTCAAGGAAAGCCCCAATCCACCACC
              AAGAGCCGGAAGAAGAGAGAGATCAGGAGCACACCCTCACTGGCATGGGAGATTGGTGCTGAAAACAGTC
              GAGGAACAAACATCCAGCACATTGCCCTGGACCGCACCAAGAGGCAGATCCCCCATGGGAGAGCACCTCC
              AGATGGCATCCTCCCCTGGGAGCTCAACAGCCCCAGCTCTGCAGTCAGCCTGGTCACTGTGGTGGGAGGC
              ACCACGGTAGGGTTACTCACCATCTGCCTCACTGTCATTGCAGTGCTGATGTGCAGGGGCAAGGAAAGTT
              TCAGGGGGAAGGATGCCCCGAAAGGCTCCAGCAGCAGTGAGCCCATGGTGCCCCCACAGAGCCATCACAA
              TGACAGCTCAGAAGTTTGATGACTGCAGGTAGAATTCAACCTTTTCCGTAAGTGCCTCGGAAAAGATCAC
              AATGGAACCTTAAATACTTCTGGTAAACCATAGAGAATGGAGGATGGCTGTGATGAAGCTGCTTAGAGAA
              TATGACTGTACTAATGGAGTTTGATTTGAATTCTCCATACTCTTTTTTGCATCAAAGGACAAATTAAGGC
              ATCTTTCCTCTTGCCCCAAAGGCAGCAACAACGTACTCATATGTACACAGAGCCATGATGTGAGGAATGT
              ACTCCTCATTTTAGACATATTCTCTATGCAGTGGAGATAAATCTATTAAAAGGTGCTAACAGACTCTCTT
              ACAAGTGTAAGAGGAATCTACTGTTGCTATGTTAGTGTGAATGTTGAAGGTGCAATTATCACATTGTTTA
              TTAATTGTATAACAGATTATTACTAGAAAGGTTTTTGTTGCTAGTCTGGAAAACTGGTGAACACACTGTT
              TATTATGACAAGTTTTCAAATAGGTGAAGACAGCATAGAATTATGACCAGGGTGGCTCAACCCACAAATC
              AACTGATCTACTACTTGGGAGACAGTGGAAGGAAAGATAGAGGGAAGGAAGTTCACTCACTTGAATTTGA
              ATTGCTTCTCATTCTCATCAGACTCTCCTTGTTTTGTTTGCATATTTAATTTTAAATTAAACCAAAGAAT
              ATGTTAATTCTGAAAGAGATTTTTAAGAGATGCTGCTCTGTTTTGGCATATAGTGAGTAATGGTAGAGCT
              CTTGCATGGTAATATACCTTATTGGTGCTCAACATTTGTGGGAAATTAGAGGGTTGGTGAGATTTTGGTG
              ATGAATAAATGCCATAGAGTTAGAGTCACTACAAGACAATGTTCTCTAAGAACTGAGCCTAGATGTTTGC
              AGTATTGAACCCATAAATGATAATAAGAAACATTGTTACAGATGGTGAAGGGAGAAAGTGGTATTTATTA
              ATATAATGTGTATAATCAGAGTGCCTCTTATACATACTTTATAGAATAAAGGAACATTTTGACAGATGAG
              GTTATCCCTCGGAGTAGCGTAATCACACAATAACATTTAGAACTTAAATTGGCTACAGGACATTTTATTA
              GCTTTCTATCCAGCATCTGGTCCAAACGATGGGACTCTCTGCAACTATCATTCCAGAAATGGTCTTGGAG
              GTGGCCAGAATCATTGACCATATTTTTATTTGGTTCAAGAAGACATCGCTCTGGCATCCCCAGTTCAGTG
              AACTGGTACAATGTGGTCCCTCTCAATATTTAAAAATATAATTTGTAACAGTGCTTACCATTCACCTCCC
              AAAGCCAAGGAACTTGAGTGAGCTTCCTTGGCAAGCCTCCCATTGCCTTTCTGCATCAATGTGTTTGTTA
              CCAAATAGCAGAAATTTCGCTTAGAAGGGGAAAACTTCAGCTTTCCAAAAGCTAGTAAACATGTTTCAAA
              GAAAAATAAGGTCAGGAGAAAAAGAATAATGCCTACAGATTATCCTTCAGATGCTGGCTAGAATCCCCTT
              TGACTTCTAGCCATAAGCTGGCCACATTGGACATCTTGGTCACTGCAGAATTTTAAAAGGCAAACTTCTC
              AGAACAGATGTGCACATCTTAATTTGGTGTCTGTAAGTATCAACCATTTCTTGATCAAGATAAGGAAGCA
              ACACTGATACTGAGAGAGAGGTCATATGTCCAATAGTTGCCTTTCTTCTCTTAGGCAGCTCTGCACTTCA
              TGTTCAGTTTTTTAAAAATAGACTGTAGTATCCTTTCATTGGAGAATTTACAAAAATATCATCTACAGCT
              CAAAAGTCCCACTAACGGCTTATATGAACAGAAAGTACTGTGTAGCCCAGGAGTTTATTTAGCAAGATAA
              ATAGTGGTAATTTCTTAATCATTCCCCTTTCCTTTGCTTTACCTTCTGGCAGATGCTTAGCTACTTCTTT
              GGCTACCTCATAATTTGTATGGGAATGAACATGAATTAGGGAACTTCAAATAGTGCGTAGACTTTTCCCT
              ACTTACCATTGGGTTCAATTGATGTAGACTGTTAGAGCAAGTATACTCAATCAACTTGCTGATATTTTAG
              TAGTTAACAGCTTCCGAGCCTATCATGCAATTTGGAGTCTGTCAATGAATATAGCAATCGGTGAAGCATT
              ACTGTACGAAGTCTGTTTTCAGGCTTTGGGTCAAGCTGGTTTTATACCAAATTTCACTCTACAATGCATA
              TTCTAATGAAGCTACTTTATATAAATTGGAGAGCTTATAAAATGCAGAACATTTCTATCCTATCCTACCA
              AATATTTATCCTTCTCTGTCCTCTATTCTCTTACTCTCCTCTCTCCCTTTTTCCTTCCCTTTATTCCCTT
              GAAAAAAGAGAATCTGTGGGAAATAGGCAGATATAGCTTTTTAAAATATAAAGTACTTGGGATTTTGCAT
              TATTTTTCTTAATATCTATTTACTAAGTATGTAATTTAATATACATTAATTATTTTTTGAAACTCTTGTT
              AGTGGGAAGAATATGGTAAATTTTTTGTTAAATAAAATAGACCCTTATGTTTAGCATTTTGTTTTTAGAG
              AACTATTCTGGTACTATCAGAACAAATACATAAAATAACTTCCCATAGAGAACAGGATATAGCAATAATA
              GCTCCTTAGATACTCAGTGGCTTCTGACTCCAATCAAGGTCTTGTTGATATTATATAGTAAAAATAAAAC
              CAAAAATAAATATTATTCAAGTGGCTCTTCTAAGCATGTGAATCATGAAGCACTGAAATATGTATTTTAA
              TGATGATCTTATTTATTCCCATTTTTGCCCTTAGTTAACATTTACTGGTGCTCACCTAGGATTGGCTATT
              CTGAGGGATTGCATAGAAACCAAGCTCCACTTGCTGTCCTTGGGAAGGTTATAACTGAATGCAGCTCTTT
              ATTTGGACTAAAGTGTCAGGATATGCATTAGATTCTCTCCTGAACCAAAAACACAACAGTCATTATCTGT
              GAACCATAATTTAAAAATCTTTCTAGAATAACAACAGCAGACTCCACTCTTGTTTGTCTAAAAGAGCCCT
              ACTGGGTATGGATCATTCTGATGACAGATTTATACAAAATGATTCAAACCAGTAACTTAGTAAAATTGAC
              CTTCGCAAAACCTCACTGGGGGAGTGCCTTGTAGAGCTGTGGGTGGGACTGCACATTCTTTTCCTCTTAG
              TAAAAGATAGGCCCACTTTATTCCAAGAATAACACTTAGCACATAAACTCTTCTTCCAGCTCGTTAGCAG
              CATTAGCACCTTCTGAATTCCACCCTCTCAGAAGAATCCACAGTGTTTGAACAATTTGCATAAAGGTCAG
              CTAGCATCCTGCTGCCAAGCCACTGCATAGCATTTGTGATAAGAAGGACCAACTCTAGGCTCAATATGAA
              GGGATTTAGTTCTGTAAGCAGCAAAAAAGCTTCTTTATCAAGTCATCTTACCTCTAATTCTTTTCCAGTG
              TGCCAACTCCAAAGTCAACATTAAAAATGTAAATGGACCTGTGTAAATATCACAGAGAGCTTTTCCTTAT
              ACATCTCAATGCTGAGAGTTAAAATATTCCCAGGTTAAAATTTTTTTAAAGTACCAATAATAGAGCTAAA
              TACAATGACATTTGCTTTTAAAAGGTGGATATTTTATTTCTGCTTTTTGAAAATACTTATTTAGTATTGA
              CTTGGAAGCCAATTTGGTCCTTTAATAAGTAAAGAAAATAATATGTTTAAAAATGTAAATGTTTTACAAA
              TTTGAAACTTTCATAATTGTATTAATCAGAAAACAAGCACATTGCCATTCTTTGAAACTCATGTTTCTAG
              ACATGACAGCAGTAATAAAAGGATGAAAACAAGTGTCTTCACTAAGCGTATGGCCAATAAATGGGACCCA
              AACGTTCAATCTGTTCAGTTTACCAAGGTTCAGAAATACGTAATTTAGCAGGAAACTATAAATACCAGTG
              CTATCACAGCCACACATACACACACACAGACATAAAATAACCAAACATCTCATTTCTAGGAAAGAGATAA
              CACTAAAGGCATCATAGGTTTAACTGAAATACGTTATATGAAGTTTTACAAAAAGGTCAACAGAAAGCTC
              ATTTGTGAAAACATACTCTCATGGGAGCTTCTTTAACATTAGTTCAGAGGTTAATATATTTCCTGGAGGT
              GTTTTCCTAGAATTGATTGCACTATTGCATGGTAATAACATTTAATTGTTAAGGAAACATTATATATAGG
              TTCAAATTATCCCTTAATGTTGATTTCTCCCCTTTTCCATGGATTTTGATACTAAGAAACAAAATGCTTT
              GAGATTTTGGTAACTATTTTGATTTTGATAAAACATGTTAAAATAGAAGGACATGATATTTTTCTATAGT
              TTCCATCAGGAAGAGTACATCAGAAACTTCTCCATAAGGAAAGAAAACTGACTCTCTCTTGAACTAGTGT
              TGACAAAATACACTAATGTCTTTCTTAATTTTATTTTATTAGGAGAAAAATCAGAATATTAAATTTGCAA
              ACTTTTGAACAGCAGTAATAGCTCCTTAGACACTCAGTATCTTTCTTCCCTATCTTTCAAGCACATTTAA
              TTTCTTTCCCCTGGTATTTGTTTGCTTTGTGTTTTTTCAATATTTTGTTTGCTAAAGAACAATAACAACA
              ACAAAGCTGGTCCAGCCCTGACACCTACTTTTGCTTTTTTTCTTTCTTTCTTTTAATTTGTTGAACTATA
              GGTTTCTTTCTGAGATGTATTTTTCATTCTTCCAATAATGCTCTCTTTTTCATTTCAAAACCATTACCAC
              TTTCAATATGTAATTAACATCCTCATTCATCAGAAAGCTGGTAAGTCCACACAGCATTTGTGCAGTATCC
              CTTCTGTGTAAAATGTTAAGGCTTTCAGATGAAAGAAAAAAGAACTTCCTGCAAAAGATCAAAAGCATCA
              TACTAAATAAAATGATGACAATATGTGCCTTGATTTTTCTCTCAATGGAGGTTCAACATTGACATTTAAG
              ATGTAAAAAAAATTACTTTGATGGTTTAATTAAGAATAATAAGTCAAATATCACATGTATGTAGTTCTTT
              TGGATGACCGAATACCTTAAAATGAACTAAATAACTGAAATAAAGTGTTAAAATGTTAACAGCGTTGAAG
              TTTTTAAAATTATAATTATCAAATGCACAATGTTCTTTTACTATGCCAAATGTTGCCTACACTGATTACA
              TGATTGTCACAGTTTAAGTGAATTTCTACTATGGATCTTTATTTTCCCCAATGTTTGGATCATCCTCTCA
              GATAAGAATTGTCAGTATTGCACCTCAAGAAAGAAGAAAAAATAAGAATGTAAATTTTTAAAAGCTAGCA
              TTAAAAGTAAAGAGCAGTACAATAAAAATCACTTAAAATAGAGAAAGGCAACTACTGAGTAAGAAGAAAA
              GATAATTTCTGTAAAAGCTAAATTTATGCACATTACAAAAAGTAGTCAAGTCAGTCTTCCATTGTGACTT
              CAGGAATTCAAATGCAAGTTGTTGGCAAAATATATATATACACACACACACACATACACACACATATATG
              TACATACATATATATATAGAGAGAGAGAGATAGATTTTTTTTTTTTGAGACAGAGTTTCGCTCTTGTTGC
              CCAGGCTGGAGTGCAATGGAATGATCTTGGCTCACCGCAACCTCCGCCTCCAGGGTTCAAGTGATTCTCC
              TGCCTCAACCTCCTGAGTAGCTGGAATTACAGGTGCCCACTACCATGCCTGGCTAGTTTTTGTATTTTTA
              GTAGAGACAGGGTTTCTCCATGTTGGTCAGGCTGATCTCGAACTCCCAACCTCAGATGATCCTCCCGCCT
              CCACCTCCCAAAGTACTGGAATTACAATGGCGTGAGCCACCACAAGATATTTTTAAAGCCCATTTGTCTA
              TAAAAGAAAACTCTTGGACAAGGAGCTTTGTGTTTTATAATTGTATTACGTGCCTGCTTCCTTACCAAGT
              GCCCTCCATAACACTAAGTAAATTTATATTTATCTAGCCTCTGAGTGACATATCTGTGTGTAATGGAATT
              ATTTGCAGAATTTAATAGCCTTTTTTATTTTCGCATGAGAATTTTTCAAAAACTATCAGGGTCTAGTTTT
              ATCATACATTTACTAAGTTACTACATATTGGTGGATATTGACGTTTATTCCTGGGAATCTAATTTTGCAA
              ACAATTTGGAGCCATTCAGTCATAAATTCATGTCAACAATAAGTCTTGCTGCCGCTTGTGTTTCATAACT
              ACGCTTGCTTTCCTTCAAAATATACCAAGTGTGTAATATAAATAAAGCCCATATCAATATAAAAAAAAAA
              AAAAAAAAA

              Композиционный код 6:

              5,3,5,5,3,5,5,3,4,4,1,1,3,2,3,5,5,2,5,3,3,5,5,3,5,5,3,5,5,2,3,2,5,3,5,5,3,5,3,3,4,4,4,1,1,1,2,5,5,5,
              2,3,5,2,1,1,1,1,1,1,1,1,1,1,1,4,4,2,5,5,2,3,3,5,3,4,4,4,3,5,5,5,3,5,5,2,5,3,5,3,3,1,1,4,1,3,2,1,4,1,
              1,4,1,6,1,2,5,5,3,5,5,3,1,4,1,4,2,1,1,1,1,1,3,3,2,2,5,2,4,4,1,4,4,4,4,4,4,4,3,5,5,2,5,2,1,1,1,4,2,5,
              5,3,1,1,1,1,4,1,4,1,3,3,4,4,4,3,2,5,5,3,3,5,5,5,2,4,4,4,1,1,2,4,4,4,3,5,5,3,3,4,4,4,3,5,5,3,1,4,4,1,
              1,4,1,1,4,1,1,1,4,3,5,2,2,5,5,5,2,5,5,5,2,4,1,1,4,3,1,1,1,1,4,1,1,3,5,3,1,1,4,1,1,3,1,4,1,4,1,1,4,3,
              4,1,1,1,4,4,1,4,1,3,5,5,5,2,5,2,2,5,2,2,5,2,4,1,4,1,4,1,1,1,1,4,1,3,5,3,5,5,5,3,4,4,4,3,1,4,4,4,1,1,
              3,1,4,1,4,4,1,4,1,1,1,1,1,1,1,2,1,1,1,1,4,1,1,4,1,1,1,1,4,4,3,5,3,2,3,1,1,1,1,4,1,1,3,2,2,5,3,5,2,1,
              1,4,1,3,1,4,6,1,1,3,3,5,5,3,2,5,5,5,3,5,5,2,5,5,3,5,2,2,1,1,1,1,2,1,6,4,4,1,4,3,2,2,5,3,3,5,5,5,3,3,
              5,3,1,1,1,1,1,3,4,4,1,1,2,2,4,1,1,1,3,2,5,5,5,3,1,4,1,6,6,6,6,1,4,1,1,3,2,4,4,1,4,1,2,4,4,4,2,5,5,3,
              3,5,3,5,3,1,4,1,1,1,1,3,3,3,2,5,5,3,1,1,1,1,1,4,1,1,3,3,1,1,4,1,3,5,5,5,3,5,5,3,4,4,1,4,1,3,1,1,1,1,
              3,3,3,5,3,1,1,1,1,1,3,3,5,3,5,5,2,5,3,2,3,2,2,3,2,5,3,3,5,5,5,2,4,4,1,1,6,1,2,5,3,4,4,1,1,4,3,5,3,3,
              3,5,3,5,3,5,3,5,5,5,2,5,3,2,5,3,3,5,3,1,1,1,1,1,3,5,3,5,2,3,2,5,5,2,4,4,4,3,4,4,4,3,3,5,3,5,3,5,3,3,
              5,3,5,5,3,3,5,5,5,3,2,5,3,5,5,2,1,1,1,4,1,1,1,3,3,5,3,1,1,4,4,1,1,1,4,4,3,4,4,4,3,2,2,1,1,1,1,2,5,3,
              4,1,1,1,1,3,5,3,5,3,5,5,2,3,3,5,3,1,1,4,4,4,2,5,2,5,3,3,2,4,1,1,4,1,3,5,5,3,2,3,5,5,3,2,3,3,3,5,5,3,
              3,5,5,5,2,5,5,3,3,5,5,3,5,3,5,5,3,3,5,3,5,3,5,5,5,3,3,5,3,5,3,1,1,1,1,4,2,3,3,5,2,2,5,2,1,1,1,1,1,1,
              2,2,1,1,1,4,1,3,3,5,3,5,5,3,3,3,5,2,5,2,5,5,5,2,3,3,5,5,3,5,3,5,3,3,3,4,4,4,2,5,5,3,5,3,3,5,3,3,5,3,
              5,5,3,4,1,4,1,3,5,3,5,3,3,5,5,2,5,3,5,5,5,2,2,4,1,1,1,1,4,1,1,3,5,5,5,2,3,5,2,3,2,3,5,2,5,3,5,5,5,2,
              5,2,5,3,3,5,5,2,5,2,5,3,1,1,1,1,3,5,5,5,2,1,4,4,1,3,3,5,3,1,1,1,1,3,3,3,3,3,5,3,5,5,3,3,3,4,4,4,3,3,
              2,4,1,1,1,1,1,1,4,3,5,2,3,5,3,5,3,2,3,5,3,5,3,5,5,3,1,4,1,1,1,2,3,1,1,1,1,1,1,1,3,3,5,5,5,3,1,1,1,4,
              3,5,2,1,1,1,4,3,3,2,5,3,3,3,5,3,5,3,5,3,5,3,5,2,5,3,3,5,5,5,3,5,3,2,4,4,4,3,2,5,3,1,1,1,1,1,1,2,3,5,
              5,2,3,5,3,5,3,3,4,1,1,1,4,3,3,1,1,1,1,3,5,3,5,3,3,3,4,4,1,1,3,5,3,2,3,5,5,2,5,3,3,3,5,5,2,5,5,3,3,3,
              5,3,5,5,5,3,2,3,5,3,3,3,5,3,3,3,5,3,5,3,3,3,5,5,5,3,5,3,3,3,1,1,6,1,3,5,5,5,3,3,2,3,5,3,5,3,5,5,5,3,
              5,3,2,2,5,5,3,3,3,1,1,1,1,1,1,3,3,2,3,5,5,5,3,3,5,2,5,2,5,3,3,5,3,3,3,5,5,3,5,2,3,5,3,3,3,5,3,3,3,5,
              3,3,5,3,2,3,3,2,1,4,1,1,4,3,3,3,5,5,5,2,3,5,3,2,3,3,5,5,2,2,5,3,3,3,3,3,3,2,2,2,5,3,2,3,3,3,3,1,1,1,
              4,3,3,1,1,1,1,3,2,3,3,5,3,3,2,3,3,3,3,5,3,3,2,2,2,5,3,5,3,2,3,2,5,3,5,2,3,3,5,5,5,3,3,1,1,1,1,1,2,5,
              3,5,5,3,5,3,3,5,5,3,3,5,5,5,2,3,2,3,3,3,3,3,5,3,5,3,2,5,3,1,1,1,1,3,2,5,3,5,5,3,3,3,5,2,5,5,3,5,3,3,
              3,5,5,5,3,5,5,3,5,2,3,3,2,5,3,5,3,3,3,3,3,3,3,5,5,3,3,3,3,5,3,3,5,3,5,5,3,3,3,5,5,5,3,5,5,2,3,5,5,3,
              5,5,3,1,1,1,1,3,5,5,2,5,3,5,5,3,3,3,5,3,3,1,1,1,1,1,3,5,3,3,5,3,3,2,2,3,5,5,5,3,5,3,1,4,1,1,3,2,3,5,
              3,3,3,3,5,5,5,3,5,3,5,3,3,2,2,3,2,3,3,5,3,5,5,3,5,5,5,3,2,3,5,2,2,3,3,3,2,3,5,3,3,5,3,3,3,3,3,3,5,2,
              2,3,5,3,3,5,3,2,3,3,3,3,5,3,3,3,5,2,5,5,5,3,3,5,5,3,3,2,5,3,5,3,3,5,3,5,3,5,5,3,5,5,3,5,5,2,3,3,3,3,
              5,3,3,2,2,3,5,5,2,3,3,5,3,3,4,1,1,4,1,3,5,3,5,5,3,3,5,2,3,5,2,5,5,5,3,3,3,5,3,5,3,3,2,2,5,2,2,5,3,3,
              5,5,5,3,3,3,3,5,5,3,3,1,1,1,1,3,5,5,2,3,5,5,3,5,5,3,5,3,3,4,1,1,4,3,5,3,5,5,3,5,3,2,5,3,1,1,1,1,1,2,
              3,3,3,3,5,3,5,5,3,3,5,3,3,5,5,3,2,3,5,3,5,3,5,2,5,3,5,5,3,5,3,5,5,3,3,5,2,4,1,1,1,1,1,4,3,5,3,3,3,3,
              4,4,4,3,3,3,3,5,5,3,5,3,5,3,3,3,3,1,1,1,4,3,5,3,1,1,1,4,3,3,3,5,3,5,2,5,5,3,5,3,3,5,5,3,3,5,5,3,5,5,
              3,3,5,3,5,5,5,3,3,3,5,3,5,2,3,3,3,1,1,1,1,2,5,3,3,5,5,3,2,5,5,3,3,3,3,3,5,5,3,3,2,5,3,5,3,4,6,1,1,1,
              1,1,3,3,5,5,3,5,5,3,5,2,5,3,5,5,5,3,2,3,5,3,2,5,3,1,1,1,4,1,6,1,2,5,3,2,5,3,5,5,5,3,5,5,3,5,3,3,3,3,
              3,5,5,2,5,5,3,3,3,2,3,3,1,1,4,1,3,1,1,1,1,1,3,5,5,2,3,3,5,3,3,5,5,3,2,5,3,5,3,3,3,5,3,3,5,2,3,3,5,5,
              3,3,2,3,3,3,3,3,2,5,5,3,5,5,5,3,3,3,5,3,5,2,5,5,5,3,3,5,3,3,5,5,5,3,5,5,5,3,3,2,3,3,3,3,3,3,3,3,5,5,
              2,3,3,3,3,2,3,3,5,2,3,5,3,3,2,3,3,5,3,1,1,1,1,3,2,5,3,3,4,1,1,1,2,1,1,1,1,1,2,5,2,4,4,1,4,3,3,5,5,3,
              5,5,3,3,5,3,5,5,2,5,2,1,1,4,4,3,5,5,3,5,5,2,5,5,3,3,5,5,3,3,2,2,3,5,2,3,5,3,3,5,5,5,3,5,5,3,3,3,3,3,
              3,5,5,5,3,1,1,1,1,1,2,3,4,1,1,1,1,6,4,1,3,3,5,3,3,2,2,2,3,2,3,5,5,3,5,5,5,3,5,3,3,5,2,5,5,3,1,1,1,1,
              3,3,5,5,3,5,3,3,3,5,5,3,5,3,5,2,5,2,3,3,5,3,1,1,1,1,1,3,5,5,3,5,3,4,1,6,1,6,4,2,3,5,2,2,5,5,2,5,3,3,
              3,2,5,3,3,5,3,3,3,3,5,5,3,5,5,3,3,5,3,5,3,5,3,5,3,3,5,3,5,3,4,1,4,1,3,5,5,3,1,4,1,1,3,3,3,5,2,5,5,3,
              5,3,2,3,3,5,3,2,3,3,2,2,5,3,4,1,1,1,3,3,3,3,3,2,3,2,1,1,6,1,3,3,3,3,5,3,5,3,5,3,2,3,2,5,5,5,2,3,5,3,
              3,3,5,5,3,5,5,3,5,5,2,5,3,1,1,1,1,3,5,2,5,5,2,3,5,3,5,5,3,5,3,5,5,3,5,3,3,2,2,3,3,5,5,3,3,3,5,5,2,3,
              2,5,5,3,5,3,5,3,5,5,5,3,3,2,5,3,1,1,1,4,1,4,3,2,1,4,6,6,1,3,3,3,5,2,5,3,3,1,1,1,1,2,5,5,3,3,5,2,3,5,
              5,5,3,3,1,4,6,1,3,5,5,3,5,5,2,1,1,1,1,4,2,5,5,3,2,3,5,5,3,5,3,5,3,2,3,3,3,3,3,3,3,5,2,5,5,2,3,3,3,3,
              5,3,3,3,3,3,2,3,5,3,3,3,5,3,3,5,3,3,3,2,4,4,4,3,2,3,3,2,5,3,5,3,2,5,3,2,5,3,5,3,5,3,1,1,1,1,3,1,4,1,
              1,3,2,3,5,5,5,3,5,2,3,3,3,5,3,5,3,5,3,1,1,1,4,3,3,5,3,3,5,3,4,4,4,3,5,5,3,5,5,5,3,3,5,2,3,3,3,3,3,5,
              2,2,1,6,1,1,4,3,5,3,5,5,2,3,3,6,1,1,6,2,3,5,3,3,3,3,5,3,3,3,2,1,4,1,6,3,5,5,3,5,3,3,5,5,3,3,3,5,5,3,
              5,3,3,5,5,3,5,2,3,5,5,5,3,3,2,5,5,3,3,2,5,3,5,3,2,3,5,5,5,3,5,3,1,4,4,1,4,1,4,3,3,2,3,5,5,3,5,3,5,5,
              5,3,5,3,3,4,1,1,1,1,3,3,5,2,1,1,6,1,2,5,5,5,2,5,3,5,3,4,4,4,2,5,5,2,3,3,3,5,5,5,3,5,3,3,1,4,1,1,6,1,
              3,3,2,5,5,5,3,3,3,3,3,3,5,5,3,2,3,5,3,3,2,2,5,5,5,2,3,3,5,5,5,2,5,3,5,3,2,5,5,2,5,3,5,5,5,3,5,2,5,2,
              5,2,3,1,6,1,1,4,1,1,3,3,5,3,5,5,3,1,1,1,1,1,3,3,5,2,3,3,2,1,1,1,1,1,1,1,4,3,3,3,3,5,5,3,3,3,3,5,5,3,
              3,3,5,3,3,2,3,2,3,2,5,2,3,3,1,1,1,1,1,1,1,3,3,5,3,1,1,1,1,1,4,1,4,1,2,5,5,3,3,5,5,5,3,5,5,3,5,5,2,3,
              5,3,3,5,3,3,5,5,3,2,2,3,2,5,5,2,5,2,5,5,5,3,5,5,3,2,5,3,5,3,3,1,1,4,1,3,1,1,4,4,2,2,5,5,5,3,3,5,5,5,
              2,5,3,3,2,3,3,4,1,1,1,1,1,1,1,3,3,2,3,5,5,5,2,5,3,3,3,3,3,3,5,3,2,1,1,6,1,1,3,3,1,4,1,1,1,4,1,1,1,2,
              5,3,5,5,3,5,3,3,5,5,2,3,5,2,5,3,2,5,2,5,5,5,2,3,3,3,2,5,5,2,3,1,1,1,1,2,5,3,3,2,5,3,5,5,2,2,1,1,1,1,
              3,5,3,5,3,5,2,3,5,5,2,5,5,3,3,4,1,4,4,2,5,3,5,2,2,3,5,3,4,4,4,2,1,1,1,1,1,3,3,3,5,5,3,5,3,5,5,2,5,3,
              5,5,3,3,2,5,3,3,5,3,1,1,1,1,3,6,1,4,1,3,5,5,3,5,5,5,3,3,2,5,5,2,5,5,3,5,3,3,3,3,3,2,3,3,3,2,3,3,3,3,
              4,4,4,3,3,5,5,3,5,3,5,5,3,5,5,5,3,4,4,4,3,2,5,3,2,3,3,5,3,3,5,5,3,3,2,5,3,2,3,3,5,5,3,5,5,3,3,2,5,3,
              3,3,3,3,3,5,5,3,3,5,2,5,2,3,5,5,3,3,2,3,5,2,3,3,5,3,2,2,5,3,5,3,3,5,3,5,3,5,3,5,3,2,3,3,2,3,3,5,5,2,
              2,2,5,3,5,5,3,2,5,2,3,5,3,2,3,5,5,3,2,5,3,5,3,5,3,5,3,2,3,3,5,3,3,3,5,5,5,3,3,5,5,3,3,2,5,5,3,1,1,1,
              1,1,4,1,1,3,1,1,1,1,2,5,2,5,2,5,5,3,3,3,3,5,3,2,2,2,1,1,1,1,3,1,4,1,1,1,1,1,1,1,1,3,5,3,2,3,2,3,1,1,
              1,1,1,1,1,1,1,1,1,3,2,1,1,4,1,3,5,5,2,4,4,4,2,5,3,1,1,1,1,1,3,5,3,2,4,4,6,1,1,1,1,3,3,1,1,4,1,3,5,5,
              3,1,1,1,1,3,1,1,6,4,1,2,5,5,3,5,3,5,5,2,3,3,1,1,4,1,2,3,5,5,3,5,3,5,5,5,2,3,3,5,3,2,5,3,3,3,3,3,3,2,
              5,3,5,5,3,5,3,3,3,3,3,5,3,2,1,4,1,1,1,3,5,3,5,3,5,3,3,3,3,5,5,3,2,3,3,5,2,3,1,1,1,1,3,5,5,3,3,3,3,3,
              5,5,2,5,2,5,3,5,3,3,3,3,3,3,3,3,3,5,3,2,5,5,2,3,2,3,3,3,3,5,3,5,3,5,5,3,5,5,3,2,5,5,2,3,5,3,3,3,5,5,
              5,3,3,5,3,3,3,5,5,3,5,3,3,3,2,3,5,3,5,5,2,5,5,3,3,3,3,5,3,3,3,3,5,5,3,2,3,5,5,3,5,3,3,3,6,1,1,4,3,3,
              5,2,3,3,4,1,1,1,1,2,5,3,2,5,3,3,3,5,5,3,3,5,2,3,3,3,3,5,3,5,3,5,5,3,5,5,5,3,3,5,3,3,5,3,5,3,3,2,5,3,
              5,3,3,5,3,5,3,3,5,3,5,5,3,3,5,2,3,3,1,1,1,1,1,3,5,5,2,2,5,3,3,3,3,3,3,5,5,3,3,3,4,4,4,3,3,5,5,5,2,3,
              5,2,5,3,5,2,2,3,5,3,3,5,5,3,5,5,2,3,3,5,3,3,3,5,2,3,3,3,5,3,3,3,5,3,1,1,1,1,3,5,2,3,3,3,2,5,3,2,5,3,
              5,3,3,2,3,3,3,5,3,3,2,2,3,1,1,6,1,3,5,5,2,2,5,5,2,5,3,5,3,5,5,3,3,5,2,5,5,3,3,3,3,5,3,2,2,3,3,2,5,3,
              5,3,5,5,5,3,3,5,3,3,3,3,2,3,5,5,3,3,5,2,3,3,3,5,3,3,3,5,5,3,5,2,5,2,3,5,5,3,3,2,6,1,1,1,2,2,3,3,3,2,
              3,3,5,3,3,5,3,2,3,5,3,5,5,3,3,5,5,3,5,5,2,5,5,2,5,3,5,5,5,3,5,3,3,5,3,5,5,3,3,5,3,3,5,3,5,5,5,3,2,3,
              3,3,3,3,3,2,5,3,3,5,5,5,3,3,3,2,5,3,2,3,3,3,2,3,3,5,5,3,5,3,5,3,2,5,2,5,5,2,3,5,2,3,5,2,5,5,3,3,3,5,
              3,3,3,5,5,3,3,2,3,3,3,5,5,3,2,3,5,5,3,1,1,1,1,2,5,5,3,1,1,1,1,1,3,3,3,5,5,3,3,5,3,3,3,3,1,1,1,1,3,2,
              3,2,3,3,5,3,5,3,2,2,5,3,3,5,3,3,5,3,3,1,1,1,1,2,3,5,2,2,5,3,3,5,5,3,5,5,3,2,5,5,5,3,3,5,3,3,3,5,5,5,
              3,3,3,3,5,3,5,3,5,3,1,1,1,1,6,3,5,5,5,3,5,5,5,2,3,3,5,2,5,5,5,3,5,2,3,2,3,3,5,5,3,3,5,5,3,2,5,3,2,3,
              3,2,5,3,5,5,5,3,3,3,2,3,5,5,3,3,3,3,5,5,3,5,5,2,2,5,3,5,5,3,5,3,3,3,5,3,5,5,5,3,3,2,2,3,5,3,2,5,3,5,
              2,5,5,3,3,5,3,3,5,3,2,5,3,3,2,5,5,2,3,3,2,3,5,3,3,3,3,5,5,5,3,3,5,2,5,5,3,2,3,5,3,5,3,3,2,5,3,5,3,3,
              5,5,3,3,3,5,3,3,5,3,3,3,3,3,3,5,2,3,5,5,2,5,3,3,3,2,5,3,3,5,3,3,2,3,3,5,3,2,3,3,5,5,2,3,3,3,2,5,3,3,
              3,3,5,3,5,5,3,5,2,3,2,5,5,3,3,3,5,2,3,5,5,3,5,3,5,3,5,3,3,5,5,3,3,3,3,5,3,2,3,2,5,3,5,5,2,5,3,2,2,3,
              5,3,3,5,5,3,3,3,5,5,3,5,3,2,1,1,1,1,1,2,3,3,3,3,3,3,5,3,3,3,3,3,2,3,5,3,3,5,3,5,3,3,3,2,5,3,3,2,3,5,
              5,5,3,3,3,5,2,3,5,5,3,3,5,3,5,5,5,2,3,5,3,5,3,3,5,2,5,3,3,5,3,3,2,3,3,5,3,5,5,3,2,3,3,5,5,3,3,3,2,2,
              5,3,5,3,5,3,5,3,1,1,1,1,3,5,2,2,5,3,5,3,3,2,5,3,3,3,3,3,3,2,2,2,2,5,5,3,3,3,3,2,3,1,1,1,1,2,5,5,3,5,
              5,2,3,3,5,3,5,3,3,5,3,5,3,2,3,5,5,5,2,3,3,4,4,4,3,1,1,1,1,3,4,1,1,1,2,5,3,5,3,5,5,5,2,5,2,3,3,5,5,3,
              5,3,5,5,2,5,3,3,4,4,4,3,2,2,3,2,3,3,3,5,5,3,5,3,3,5,5,3,3,5,2,3,5,2,1,1,1,1,3,3,3,5,5,2,5,3,5,3,3,3,
              5,5,5,3,5,5,3,3,3,3,5,3,5,5,3,5,5,3,3,5,5,3,5,5,2,3,1,1,1,1,3,5,3,5,2,3,2,5,2,2,3,3,6,1,6,1,4,3,3,3,
              5,3,5,3,5,3,2,3,5,3,3,5,3,5,3,3,5,5,3,3,3,3,5,3,5,3,3,3,3,3,5,3,5,3,5,3,4,4,4,3,3,3,3,5,3,3,3,3,3,3,
              3,2,5,3,5,5,2,3,5,5,3,3,5,5,3,3,5,3,3,5,3,3,3,3,3,2,3,5,3,3,2,5,5,3,5,2,3,5,5,5,3,5,3,3,5,5,2,3,5,5,
              2,1,1,1,1,1,1,3,3,5,5,3,3,4,4,4,3,5,3,5,5,2,5,3,3,2,5,3,2,3,5,3,3,2,3,2,3,3,3,2,2,5,3,3,5,5,5,3,5,5,
              5,2,5,2,5,2,5,2,3,5,2,5,5,2,3,2,2,5,3,1,1,1,1,3,3,5,3,5,5,3,5,3,3,3,3,3,3,3,3,3,5,3,3,3,5,5,3,3,3,5,
              5,2,3,3,3,2,3,3,5,5,3,2,3,1,4,1,4,3,5,5,3,5,5,5,3,5,5,2,2,2,3,3,3,5,2,5,3,2,3,5,5,3,3,5,3,3,3,3,5,5,
              3,3,2,5,3,5,2,2,3,5,3,5,3,5,3,3,3,5,3,3,3,3,3,3,2,3,5,3,3,5,2,5,3,3,3,2,3,1,1,1,1,3,2,2,3,3,3,2,5,2,
              5,3,3,5,3,1,1,1,1,3,5,3,3,2,2,5,3,5,3,3,3,3,3,5,5,3,3,5,3,3,3,3,2,5,3,5,2,2,2,2,3,3,5,2,5,3,5,3,3,5,
              3,3,2,5,2,3,3,5,3,5,5,2,3,3,5,3,5,3,3,3,3,3,3,5,5,3,2,2,2,2,2,1,4,1,1,1,1,1,2,3,5,3,3,5,3,3,3,3,3,5,
              5,5,3,5,3,3,3,5,5,3,3,2,5,5,3,5,5,3,3,3,3,5,3,5,3,5,3,5,3,5,5,3,2,5,2,5,5,3,5,5,2,3,2,5,5,3,3,2,2,5,
              3,5,3,3,5,3,5,3,2,3,3,3,3,1,1,1,4,3,5,5,3,5,5,2,2,3,3,5,5,2,2,3,5,5,3,3,5,2,5,5,3,3,3,5,3,3,3,3,3,3,
              3,5,3,3,3,3,3,5,3,3,5,2,3,5,2,3,5,5,5,3,5,5,5,3,5,3,3,5,5,5,2,3,3,2,5,3,5,3,3,5,5,3,3,3,3,3,3,2,3,5,
              3,5,2,5,5,3,5,3,5,3,3,5,2,5,5,3,3,3,3,5,3,3,3,3,3,2,2,5,5,3,3,5,5,3,3,1,1,1,1,2,3,5,3,3,5,3,5,5,2,3,
              5,5,3,3,5,3,3,3,3,3,3,3,5,3,3,3,3,5,5,5,3,3,3,5,3,3,5,3,5,2,3,3,5,5,3,3,5,2,3,3,2,3,3,3,3,5,5,3,2,3,
              3,3,3,5,3,3,2,5,5,3,5,3,5,3,1,1,1,1,2,3,3,2,3,2,5,2,5,2,5,2,5,2,3,2,3,2,3,2,3,3,5,3,5,2,3,3,3,3,5,3,
              5,3,5,3,3,3,5,5,3,2,5,3,5,3,3,3,5,2,5,3,3,5,3,2,4,1,1,1,1,1,1,1,1,1,4,3,5,5,3,5,5,5,2,2,2,5,5,3,3,3,
              3,3,3,3,3,5,5,3,3,2,3,5,2,5,5,3,2,3,5,5,5,3,1,1,1,1,1,1,1,2,5,5,5,3,5,3,1,4,1,1,1,1,2,3,3,5,5,3,3,2,
              5,5,3,3,3,2,3,2,3,5,3,3,2,3,2,3,3,5,5,5,3,5,5,5,3,2,5,5,5,2,3,3,3,3,3,1,1,1,4,2,3,5,3,2,5,3,3,3,2,3,
              3,3,5,3,3,3,3,5,5,3,3,3,3,3,2,2,5,3,3,3,5,2,3,3,2,3,5,5,2,5,5,3,3,5,3,3,5,5,3,3,3,3,2,5,3,5,5,2,5,3,
              3,3,5,5,2,2,2,3,3,3,5,3,3,3,2,5,2,5,5,3,5,5,3,2,5,3,5,3,3,2,3,3,5,3,5,3,2,3,3,3,3,3,

              Вторичная структура (Пикотех-2017) весит около 6 мегабайт в стандарте PNG: https://cloud.mail.ru/public/KKjH/goMgmMGAn

              На яндекс-фотки не грузится. Но самый интересный фрагмент удалось вырезать в программе Paint:



              Сиреневым цветом отмечен виток необычной метиониновой спирали. В отличие от альфа-спирали у неё более длинный шаг. Метиониновая спираль отличается от обычной альфа-спирали примерно как резьба с более крупным шагом от резьбы с менее крупным шагом:


              Шаг метиониновой спирали примерно на 25% крупнее шага обычной альфа-спирали. При этом на один виток приходится тоже 3.6...3.7 аминокислотных остатка Met.

               



              Ещё один интересный участок этого белка 3916...4164. Он содержит все типы композиционных кодов: 1,2,3,4, но ... не содержит ни одного витка спирали! Интересно оценить вероятность случайной комбинации композиционных кодов такого типа. Напомню, что спираль возникает при трёхкратном (или более) повторении кодов 1, 4 или их комбинации. При этом третий код должен быть "4", либо спиральных кодов (1,4), идущих подряд, должно быть больше 3.

               

               




              Белковая молекула кончается витком полилизиновой пи-спирали, похожей на винт Архимеда.

               

               

               


              Фрагменты моделей белков, замкнувшихся через дисульфидные мостики в процессе автоматической сборки по таблице композиционного генетического кода.

              *

              *

              СМ.  СТР. 24-27






              Вероятность случайного совпадения результата работы геометрического алгоритма с экспериментальными данными ничтожна. Для каждого участка отдельно она не превышает:

              1. 4^-18
              2. 4^-21
              3. 4^-4
              4. 4^-4
              5. 4^-12

              Вероятность угадать все 5 участков не превышает 4^-(18+21+4+4+12)=4^-59 Примерно такая же вероятность случайно нащупать иголку в стоге сена размером с Солнечную систему, не вынимая руки из кармана.



              Обнаружился 6-ой фрагмент, замкнутый через дисульфидный мостик. На этот раз это Met 1 - Cys 24 куриного яйца.

              Рекордная длина фрагмента и рекордно малая вероятность случайного замыкания 4^-23 = 1.4*10^-14.

              В этом фрагменте встречаются два одиночных кода 310-спирали ("5") и два кода 310-спирали в составе спиралей ("4"). Поэтому старая версия Пикотех даёт ошибку при любой настройке композиционных углов варианта "4". Минимальная ошибка получается в случае правильных углов в составе спирали. Этот вариант и помог обнаружить ещё один дисульфидный мостик куриного лизоцима.





              Обнаружены дисульфидные мостики Met-Cys!

              Пикотехнология белков, ДНК, РНК - 2 

               


              В мышином лизоциме обнаружился дисульфидный мостик между атомом серы Cys 13 и атомом серы Met 1. При этом угол 310-спирали делает структуру этого фрагмента лизоцима напряжённой, т.е. дополнительно прижимает группы атомов, как бы пытаясь вдавить атомные группы друг в друга.










              Пикотехнологическая модель фрагмента мышиного лизоцима (ядра+электронные поверхности)



               

               





              Пикотехнологическая модель мышиного лизоцима. Пока неточная, но структуру в общих чертах уже видно.




               





              Обнаружился 6-ой фрагмент, замкнутый через дисульфидный мостик. На этот раз это Met 1 - Cys 24 куриного яйца.



              Рекордная длина фрагмента и рекордно малая вероятность случайного замыкания 4^-23 = 1.4*10^-14.

              В этом фрагменте встречаются два одиночных кода 310-спирали ("5") и два кода 310-спирали в составе спиралей ("4"). Поэтому старая версия Пикотех даёт ошибку при любой настройке композиционных углов варианта "4". Минимальная ошибка получается в случае правильных углов в составе спирали. Этот вариант и помог обнаружить ещё один дисульфидный мостик куриного лизоцима.










              В общей сложности построены модели 6 замкнутых через дисульфидные мостики участков.

              1. Cys 95 - Cys 113 в человеческом лизоциме.
              2. Cys 96 - Cys 117 в альтернативном человеческом лизоциме.
              3. Cys 78 - Cys 82  в альтернативном человеческом лизоциме.
              4.  Cys 94 - Cys 98  в лизоциме куриного яйца
              5.  Met 1 - Cys 13  в мышином лизоциме
              6.  Met 1 - Cys 24  в лизоциме куриного яйца