Перевести страницу

Пикотехнология вкратце

Открыт новый тип белковой структуры - метиониновая спираль

*

*



    Пикотехнология белков, ДНК, РНК - 2

    http://www.myshared.ru/slide/643151/

    Цитата: 15  МЕТИОНИН - незаменимая АМК. Необходима для синтеза белков, участвует в реакциях дезаминирования, является источником серы для синтеза цистеина. Метионил-тРНК участвует в инициации трансляции. Метильная группа метионина - мобильный одноуглеродный фрагмент, используемый для синтеза ряда соединений в реакциях переноса этой группы на соответствующий акцептор (реакция транс- метилирования) Метильная группа в молекуле метионина прочно связана с атомом S, поэтому непосредственным донором этого одноуглеродного фрагмента служит активная форма метионина - S-аденозилметионин (SAM) 
    16  S-аденозилметионин (SAM) - сульфониевая форма метионина, образующаяся при его присоединении к молекуле аденозина (продукта гидролиза АТФ) Реакция активации метионина Присутствует во всех типах клеток Структура (S + -CH 3 ) в SAM - нестабильная группировка, определяющая высокую активность метильной группы (отсюда термин «активный метионин»). Это уникальная реакция, единственная, в результате которой освобождаются все три фосфатных остатка АТФ. Отщепление метильной группы от SAM и перенос ее на соединение -акцептор катализируют метилтрансферазы в реакциях транс- метилирования. SAM в ходе реакции превращается в S-аденозилгомоцистеин (SAГ). 
    Конец цитаты.

    Кушелев: Понятно. Связь Met-Cys косвенно подтверждается, т.к. Cys образуется из Met, а значит, что в мышином лизоциме тоже возможно превращение Met в Cys в процессе дозревания белка.

    https://img-fotki.yandex.ru/get/196070/158289418.3c3/0_17074a_a85f2577_XL.gif



    Открыт новый тип белковой структуры!

    http://nanoworld.org.ru/post/82432/#p82432

    >NM_207361.5 Homo sapiens FRAS1 related extracellular matrix protein 2 (FREM2), mRNA
    GGGATTTCCCTCAAAGCCCAGGGTCCGGGGACCTGGAAAGTAGAAGTGGAGGGATTCAATTCTCCGCGCG
    ATTGAGGCGCTAGCGGCGGAGCTGGACGGCCTGGGAAGGCTTCGGCTCCTCGGCTGCGGCTCCAGCCCGG
    ACGGCGCCGCGCAACTTTGCCATCCTTCTGGCCCAGCCCCGGCTACAGGAGGACCCCGCGGGCAACGCGC
    GGAGTTCCTGGCACTTCCCGGCGGTGTCTCTTGTTGTCTGCCCGGGGACCGACTTCGCATGCTCTCAGGC
    TGACCTGTCCAAGCCCGAACACCGGGACCATGCACTCAGCCGGGACTCCCGGGTTATCCTCGCGCCGGAC
    AGGCAACTCCACCAGCTTTCAACCAGGACCGCCACCGCCGCCCCGGCTGCTGCTGCTGCTGCTGCTTCTC
    CTGTCACTGGTAAGCCGCGTCCCGGCACAGCCCGCTGCCTTCGGCAGGGCGTTGCTGTCCCCTGGTCTCG
    CGGGGGCTGCAGGGGTCCCTGCTGAGGAGGCCATAGTGCTGGCGAACCGCGGACTCCGGGTGCCTTTCGG
    CCGTGAAGTCTGGCTGGATCCCCTGCATGACCTGGTGTTGCAGGTGCAGCCCGGGGACCGCTGCGCGGTT
    TCGGTACTAGACAACGACGCACTGGCCCAGCGACCGGGCCGCCTGAGTCCCAAGCGCTTCCCGTGCGACT
    TTGGCCCTGGCGAGGTGCGCTACTCTCACCTGGGCGCGCGCAGCCCGTCTCGGGACCGCGTCCGGCTGCA
    GCTGCGCTATGACGCGCCCGGAGGGGCAGTAGTGCTACCACTGGTACTGGAGGTGGAGGTGGTCTTCACC
    CAGCTGGAGGTTGTGACTCGGAACTTGCCTCTGGTCGTGGAAGAGCTGCTGGGGACCAGCAATGCCCTGG
    ACGCGCGGAGCCTGGAGTTCGCCTTCCAGCCCGAGACAGAGGAGTGCCGCGTGGGCATCCTGTCCGGCTT
    GGGCGCGCTGCCTCGCTATGGAGAACTCCTCCACTACCCGCAGGTCCCTGGAGGAGCCAGAGAGGGAGGC
    GCCCCGGAGACTCTCCTGATGGACTGCAAAGCTTTCCAGGAACTAGGCGTGCGCTATCGCCACACAGCCG
    CCAGTCGCTCACCAAACAGGGACTGGATACCCATGGTGGTGGAGCTGCGTTCACGAGGGGCTCCTGTGGG
    CAGCCCTGCTTTGAAACGCGAGCACTTCCAGGTTCTGGTGAGGATCCGAGGAGGGGCCGAGAACACTGCA
    CCCAAGCCCAGTTTCGTGGCCATGATGATGATGGAGGTGGACCAGTTTGTACTGACGGCCCTGACCCCAG
    ACATGCTGGCAGCCGAGGATGCTGAGTCTCCCTCTGACCTGTTGATCTTCAACCTTACTTCTCCATTCCA
    GCCTGGCCAGGGCTACTTGGTGAGCACCGATGATCGCAGCCTGCCCCTTTCCTCCTTCACTCAGAGGGAT
    CTGCGGCTCCTGAAGATTGCCTACCAGCCCCCTTCTGAAGACTCTGACCAGGAGCGCCTCTTTGAACTGG
    AATTGGAGGTAGTGGATCTAGAAGGAGCAGCTTCAGACCCTTTTGCCTTCATGGTAGTGGTGAAGCCCAT
    GAACACAATGGCTCCGGTGGTCACCCGGAATACCGGTCTTATTCTCTATGAGGGTCAGTCTCGGCCCCTC
    ACAGGCCCTGCAGGCAGTGGTCCGCAAAACTTGGTCATCAGCGATGAGGATGACCTAGAAGCAGTGCGGC
    TAGAGGTGGTGGCTGGGCTCCGGCATGGTCACCTTGTCATTCTGGGTGCTTCCAGTGGCAGCTCTGCTCC
    CAAGAGCTTTACAGTGGCTGAGCTGGCAGCCGGCCAGGTGGTCTACCAGCATGATGACAGAGACGGCTCG
    CTGAGCGACAACCTGGTGCTTCGCATGGTGGATGGAGGAGGCAGGCACCAGGTACAGTTTCTGTTCCCCA
    TCACCTTAGTGCCTGTGGATGACCAGCCACCTGTTCTCAATGCCAACACGGGGCTGACACTGGCAGAGGG
    TGAAACAGTGCCCATCCTGCCCCTTTCCCTGAGTGCAACTGACATGGATTCAGATGATTCTCTGCTGCTT
    TTTGTGCTGGAGTCACCCTTCTTAACTACGGGGCATCTGCTTCTCCGCCAAACTCACCCTCCCCATGAGA
    AGCAGGAACTTCTCAGAGGCCTTTGGAGGAAGGAGGGGGCATTTTATGAGCGAACAGTGACAGAGTGGCA
    GCAGCAGGACATAACAGAGGGCAGGCTGTTCTATAGACACTCTGGGCCCCATAGTCCTGGGCCAGTCACA
    GACCAGTTCACATTTAGAGTCCAGGATAACCATGACCCTCCTAATCAGTCCGGGCTACAGCGGTTTGTGA
    TTCGTATCCATCCTGTGGATCGCCTCCCTCCGGAGCTGGGCAGTGGCTGTCCCCTTCGTATGGTGGTACA
    GGAATCCCAGCTCACACCACTGAGGAAGAAGTGGCTGCGCTACACTGACCTGGACACAGATGACCGAGAA
    CTACGTTACACAGTGACTCAGCCCCCCACAGACACAGACGAAAATCACCTGCCAGCCCCACTGGGTACCT
    TGGTCTTGACTGACAACCCCTCAGTCGTGGTGACCCATTTTACCCAAGCCCAGATCAACCATCATAAAAT
    TGCTTACAGACCCCCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTTCCAGTTCCAGGTGGAA
    GACCGAGCTGGGAATGTGGCTCCAGGTACCTTTACCCTTTACTTGCATCCCGTGGACAACCAGCCACCTG
    AGATCCTCAACACCGGCTTCACTATTCAGGAGAAGGGTCACCACATCCTGAGTGAGACAGAGTTGCACGT
    GAATGATGTAGACACTGATGTTGCCCATATCTCTTTCACTCTCACTCAGGCACCCAAACATGGCCACATG
    AGAGTGTCTGGACAGATCCTGCATGTAGGGGGTCTCTTCCACTTGGAGGACATAAAACAGGGCCGAGTTT
    CCTATGCCCATAATGGGGACAAGTCCCTGACTGATAGCTGCTCCTTGGAAGTCAGTGACAGACATCATGT
    GGTGCCCATCACTCTCAGAGTAAATGTCCGGCCAGTGGATGATGAAGTGCCCATACTGAGCCATCCTACT
    GGCACTCTGGAGTCCTATCTAGATGTCTTAGAAAATGGGGCTACTGAAATCACTGCCAATGTTATTAAGG
    GGACCAATGAGGAAACTGATGACTTGATGTTGACTTTCCTCTTGGAAGATCCACCTTTGTATGGGGAAAT
    CTTGGTCAATGGCATTCCAGCAGAGCAGTTTACTCAAAGGGACATCTTGGAGGGCTCTGTTGTATATACC
    CACACCAGTGGTGAGATAGGCCTATTGCCTAAAGCGGATTCTTTTAACCTGAGTCTGTCAGATATGTCTC
    AAGAATGGAGAATTGGTGGCAATACTATCCAAGGAGTTACTATATGGGTGACCATCCTGCCTGTTGATAG
    CCAGGCCCCAGAAATCTTTGTAGGTGAACAGTTGATAGTAATGGAAGGTGATAAAAGTGTTATAACATCA
    GTGCATATAAGTGCTGAAGATGTCGACTCCCTGAATGATGACATCTTGTGCACTATAGTTATTCAGCCTA
    CTTCAGGTTATGTTGAAAACATTTCTCCAGCACCAGGCTCTGAGAAATCAAGAGCAGGGATTGCCATAAG
    TGCTTTCAACTTGAAAGATCTCAGGCAGGGCCACATAAACTATGTCCAGAGTGTCCATAAAGGGGTGGAA
    CCTGTGGAGGACCGATTTGTATTTCGTTGTTCTGATGGCATTAACTTTTCAGAGAGACAGTTCTTCCCCA
    TTGTAATCATTCCCACCAATGATGAACAGCCAGAGATGTTTATGAGAGAATTTATGGTGATGGAAGGCAT
    GAGTCTGGTAATTGATACACCCATTCTCAATGCTGCTGATGCTGATGTTCCCCTGGATGATTTAACTTTC
    ACTATTACCCAATTCCCCACTCATGGTCACATCATGAATCAGCTGATAAATGGCACGGTTTTGGTCGAAA
    GCTTCACCTTGGATCAGATCATAGAGAGTTCCAGCATTATTTATGAGCATGATGACTCCGAGACCCAGGA
    AGACAGTTTTGTGATTAAACTAACAGATGGGAAGCACTCTGTGGAAAAGACGGTCCTCATTATAGTTATC
    CCTGTTGATGATGAGACGCCCAGAATGACTATCAATAATGGACTAGAAATAGAAATTGGGGATACCAAGA
    TTATCAACAACAAAATATTAATGGCAACAGATTTAGATTCAGAAGACAAATCTTTGGTTTATATTATTCG
    TTATGGGCCAGGACATGGCTTATTACAGAGACGAAAACCTACTGGTGCCTTTGAAAATATCACACTGGGC
    ATGAATTTTACCCAGGATGAAGTAGACAGAAACTTAATTCAGTATGTCCATTTGGGGCAAGAGGGCATTC
    GGGACCTAATTAAATTTGATGTGACTGATGGAATAAATCCCCTCATAGATCGTTACTTTTATGTGTCCAT
    CGGGAGCATTGACATTGTCTTCCCTGATGTGATAAGTAAGGGAGTGTCCTTGAAAGAAGGTGGCAAAGTC
    ACTCTTACAACAGACCTACTAAGCACTAGTGACTTGAACAGTCCTGATGAAAACTTGGTTTTTACCATCA
    CCAGGGCTCCCATGCGAGGTCACCTGGAATGCACGGATCAGCCTGGTGTGTCCATCACGTCTTTCACTCA
    GCTGCAACTGGCTGGAAACAAAATCTACTACATCCACACAGCTGATGATGAAGTGAAAATGGACAGTTTT
    GAGTTTCAAGTCACCGATGGACGTAACCCTGTCTTTCGGACATTCCGTATCTCCATTAGCGATGTGGACA
    ATAAAAAGCCAGTGGTCACCATCCACAAGCTGGTTGTCAGTGAAAGTGAAAACAAGCTGATTACTCCTTT
    TGAGCTCACTGTCGAAGACAGAGATACTCCTGACAAGCTCCTGAAATTCACTATCACCCAGGTGCCTATT
    CATGGCCATCTCCTATTCAACAATACCAGACCTGTCATGGTTTTTACCAAGCAAGACTTGAATGAAAACT
    TAATCAGCTACAAACATGATGGCACTGAGTCAAGTGAAGATAGCTTCTCCTTCACAGTGACTGATGGCAC
    CCATACAGACTTCTATGTTTTTCCTGATACGGTGTTTGAAACAAGGAGACCCCAAGTGATGAAGATCCAG
    GTCTTGGCTGTTGACAACAGTGTCCCCCAAATCGCAGTGAATAAGGGGGCCTCTACACTTCGCACTCTAG
    CCACTGGCCACTTGGGGTTCATGATCACAAGCAAAATATTGAAAGTGGAGGACAGAGACAGCTTACACAT
    TTCTCTTAGATTTATCGTGACAGAGGCCCCTCAACATGGATATCTTCTCAACCTGGACAAAGGCAACCAC
    AGCATCACTCAGTTCACACAAGCTGACATTGATGACATGAAAATATGCTATGTCTTAAGAGAAGGGGCTA
    ATGCCACAAGTGATATGTTCTATTTTGCAGTTGAAGATGGTGGTGGAAACAAGTTAACGTACCAGAATTT
    TCGTCTGAATTGGGCATGGATCTCCTTTGAAAAGGAATATTACCTGGTCAATGAGGACTCCAAATTTCTA
    GATGTTGTTCTTAAACGTAGAGGTTACTTGGGAGAAACTTCTTTTATAAGTATTGGCACAAGAGACAGAA
    CTGCAGAAAAAGACAAAGACTTCAAGGGCAAAGCACAGAAACAAGTGCAGTTCAACCCAGGCCAGACCAG
    GGCCACATGGCGAGTGCGGATCCTGAGTGATGGGGAGCATGAGCAGTCTGAAACCTTTCAGGTGGTACTC
    TCAGAGCCCGTGCTGGCTGCCTTGGAATTCCCCACAGTCGCCACTGTTGAGATCGTTGATCCAGGAGATG
    AGCCAACTGTGTTTATTCCCCAGTCCAAATACTCCGTTGAAGAAGATGTTGGTGAGCTGTTCATTCCCAT
    CAGGAGGAGCGGAGATGTGAGCCAGGAGTTGATGGTGGTCTGTTATACCCAACAAGGAACAGCAACTGGA
    ACTGTGCCGACTTCCGTGTTGTCTTACTCTGATTACATATCCAGGCCTGAGGACCACACCAGTGTTGTCC
    GCTTTGACAAAGATGAACGGGAGAAACTGTGTCGGATAGTCATAATTGATGACTCTTTGTACGAGGAGGA
    GGAAACCTTCCATGTCCTTCTGAGCATGCCCATGGGGGGAAGAATCGGATCAGAGTTCCCAGGGGCTCAA
    GTTACAATCGTTCCTGACAAAGATGATGAACCCATCTTTTACTTCGGTGATGTGGAATACTCTGTGGATG
    AGAGTGCTGGCTATGTGGAAGTGCAGGTGTGGAGAACGGGCACTGACCTGTCCAAGTCTTCTAGTGTCAC
    AGTGAGGTCTCGGAAAACAGATCCTCCCTCTGCAGATGCTGGAACAGACTATGTGGGCATCAGCCGTAAT
    TTAGATTTTGCACCTGGAGTCAACATGCAGCCTGTTCGTGTTGTCATTCTGGATGACCTTGGACAACCAG
    CGCTGGAGGGAATTGAGAAATTTGAACTGGTGCTTCGCATGCCTATGAACGCAGCCCTTGGCGAGCCCAG
    CAAAGCCACAGTGTCCATAAATGACTCTGTCTCCGATTTGCCTAAGATGCAATTCAAAGAACGAATATAT
    ACTGGCAGCGAAAGTGATGGGCAGATAGTTACAATGATCCATAGGACTGGGGATGTCCAGTACAGATCTT
    CAGTGAGATGCTACACCCGGCAGGGGTCTGCACAGGTGATGATGGACTTTGAAGAACGCCCAAACACTGA
    TACCTCCATCATCACATTCCTCCCTGGTGAGACAGAAAAGCCCTGCATTCTTGAGCTGATGGACGATGTG
    CTCTATGAGGAGGTAGAGGAGCTCCGCCTGGTACTCGGCACTCCACAAAGCAACTCTCCCTTTGGGGCTG
    CAGTTGGTGAACAAAATGAAACTCTCATAAGGATCCGAGATGATGCTGATAAGACTGTTATTAAATTTGG
    AGAAACCAAATTTAGTGTCACTGAACCCAAAGAACCTGGAGAGTCGGTGGTTATAAGAATTCCAGTGATT
    CGCCAAGGAGACACTTCAAAGGTTTCCATTGTGAGAGTCCACACCAAGGATGGCTCGGCCACCTCTGGAG
    AAGACTACCACCCTGTGTCAGAAGAAATTGAGTTTAAGGAAGGGGAAACCCAGCACGTGGTTGAAATCGA
    AGTTACCTTTGACGGGGTGAGAGAGATGAGAGAGGCCTTCACTGTTCACCTAAAACCTGATGAAAATATG
    ATAGCAGAGATGCAGTTGACGAAAGCCATTGTGTACATAGAAGAAATGAGCAGCATGGCAGATGTCACTT
    TTCCTTCTGTCCCTCAAATTGTATCCCTGTTGATGTATGACGACACTTCCAAAGCTAAGGAGAGTGCTGA
    ACCCATGTCTGGCTATCCTGTCATCTGTATCACAGCTTGCAACCCCAAATATTCAGACTACGATAAAACA
    GGCTCTATCTGTGCAAGTGAGAACATCAATGACACTTTGACGCGGTACCGGTGGCTGATTAGTGCACCTG
    CGGGCCCTGACGGTGTGACCAGCCCTATGAGAGAAGTGGACTTCGACACCTTTTTTACGTCATCCAAGAT
    GGTCACACTGGACTCCATATACTTTCAGCCTGGCTCCCGGGTACAGTGCGCAGCTCGTGCTGTGAACACC
    AATGGGGATGAAGGCCTGGAGCTCATGAGCCCTATTGTAACCATCAGCAGAGAAGAAGGTCTTTGTCAGC
    CCCGTGTACCTGGGGTTGTTGGAGCAGAGCCGTTCTCAGCTAAATTGCGCTACACAGGCCCTGAGGATGC
    AGACTACACAAACCTTATCAAGCTCACTGTCACAATGCCACACATAGATGGCATGCTCCCCGTGATCTCC
    ACTAGAGAGCTTTCCAACTTTGAGCTCACCCTCAGCCCTGATGGCACAAGAGTTGGAAACCACAAGTGCT
    CCAACCTCCTGGATTATACTGAAGTGAAGACTCATTATGGTTTCTTGACTGATGCTACCAAAAATCCAGA
    AATAATTGGAGAGACATATCCTTACCAGTACAGCTTGTCCATCAGAGGTTCCACTACCTTGCGCTTCTAC
    CGGAACCTGAACCTAGAGGCCTGTTTATGGGAGTTCGTTAGCTACTATGACATGTCAGAACTCCTTGCTG
    ACTGTGGTGGCACCATTGGAACAGATGGACAGGTCCTAAACCTAGTGCAGTCCTATGTGACCCTTCGAGT
    CCCTCTGTATGTTTCCTACGTGTTCCATTCCCCCGTGGGGGTAGGAGGCTGGCAGCATTTTGACTTGAAG
    TCAGAGCTTCGTCTAACTTTTGTGTACGACACCGCCATCTTGTGGAATGATGGAATTGGCAGCCCCCCAG
    AGGCTGAACTTCAAGGTTCTCTCTATCCAACCAGCATGCGCATCGGTGATGAGGGGCGCTTGGCCGTGCA
    CTTCAAGACAGAGGCTCAGTTCCATGGCTTATTTGTGCTGTCACATCCCGCATCCTTTACAAGCTCAGTG
    ATCATGTCAGCTGATCATCCAGGCCTGACATTTTCCCTCCGCCTCATAAGGAGTGAACCAACCTATAACC
    AGCCAGTACAGCAGTGGAGCTTTGTCTCTGACTTTGCCGTACGTGACTACTCAGGGACCTATACTGTGAA
    GCTGGTGCCATGCACTGCCCCATCACATCAGGAATACCGCCTGCCAGTCACCTGCAACCCCAGAGAACCT
    GTCACCTTTGACCTTGACATCCGATTCCAACAGGTCAGTGATCCAGTGGCTGCTGAGTTTAGCTTGAACA
    CCCAAATGTACCTGCTCTCTAAGAAGAGTCTCTGGTTGTCTGATGGATCCATGGGATTCGGGCAAGAGAG
    TGATGTTGCTTTTGCAGAAGGTGATATAATTTATGGTCGTGTCATGGTGGATCCTGTCCAGAATCTGGGT
    GACTCCTTTTACTGCAGCATTGAGAAGGTGTTTCTATGCACTGGAGCTGATGGCTATGTTCCCAAGTATA
    GTCCAATGAATGCAGAATATGGCTGCTTAGCCGACTCTCCTTCACTCTTATATAGATTTAAAATTGTGGA
    CAAAGCTCAGCCAGAGACACAAGCGACCAGTTTTGGAAATGTCCTATTTAATGCCAAACTAGCAGTGGAT
    GACCCTGAAGCCATTCTCTTAGTGAATCAGCCTGGATCTGATGGATTTAAAGTCGACTCAACACCACTCT
    TTCAGGTCGCTCTAGGCCGAGAATGGTATATACATACGATCTATACAGTGAGATCGAAAGACAATGCCAA
    TCGAGGTATTGGCAAAAGAAGTGTGGAGTACCATTCTCTGGTGAGTCAAGGAAAGCCCCAATCCACCACC
    AAGAGCCGGAAGAAGAGAGAGATCAGGAGCACACCCTCACTGGCATGGGAGATTGGTGCTGAAAACAGTC
    GAGGAACAAACATCCAGCACATTGCCCTGGACCGCACCAAGAGGCAGATCCCCCATGGGAGAGCACCTCC
    AGATGGCATCCTCCCCTGGGAGCTCAACAGCCCCAGCTCTGCAGTCAGCCTGGTCACTGTGGTGGGAGGC
    ACCACGGTAGGGTTACTCACCATCTGCCTCACTGTCATTGCAGTGCTGATGTGCAGGGGCAAGGAAAGTT
    TCAGGGGGAAGGATGCCCCGAAAGGCTCCAGCAGCAGTGAGCCCATGGTGCCCCCACAGAGCCATCACAA
    TGACAGCTCAGAAGTTTGATGACTGCAGGTAGAATTCAACCTTTTCCGTAAGTGCCTCGGAAAAGATCAC
    AATGGAACCTTAAATACTTCTGGTAAACCATAGAGAATGGAGGATGGCTGTGATGAAGCTGCTTAGAGAA
    TATGACTGTACTAATGGAGTTTGATTTGAATTCTCCATACTCTTTTTTGCATCAAAGGACAAATTAAGGC
    ATCTTTCCTCTTGCCCCAAAGGCAGCAACAACGTACTCATATGTACACAGAGCCATGATGTGAGGAATGT
    ACTCCTCATTTTAGACATATTCTCTATGCAGTGGAGATAAATCTATTAAAAGGTGCTAACAGACTCTCTT
    ACAAGTGTAAGAGGAATCTACTGTTGCTATGTTAGTGTGAATGTTGAAGGTGCAATTATCACATTGTTTA
    TTAATTGTATAACAGATTATTACTAGAAAGGTTTTTGTTGCTAGTCTGGAAAACTGGTGAACACACTGTT
    TATTATGACAAGTTTTCAAATAGGTGAAGACAGCATAGAATTATGACCAGGGTGGCTCAACCCACAAATC
    AACTGATCTACTACTTGGGAGACAGTGGAAGGAAAGATAGAGGGAAGGAAGTTCACTCACTTGAATTTGA
    ATTGCTTCTCATTCTCATCAGACTCTCCTTGTTTTGTTTGCATATTTAATTTTAAATTAAACCAAAGAAT
    ATGTTAATTCTGAAAGAGATTTTTAAGAGATGCTGCTCTGTTTTGGCATATAGTGAGTAATGGTAGAGCT
    CTTGCATGGTAATATACCTTATTGGTGCTCAACATTTGTGGGAAATTAGAGGGTTGGTGAGATTTTGGTG
    ATGAATAAATGCCATAGAGTTAGAGTCACTACAAGACAATGTTCTCTAAGAACTGAGCCTAGATGTTTGC
    AGTATTGAACCCATAAATGATAATAAGAAACATTGTTACAGATGGTGAAGGGAGAAAGTGGTATTTATTA
    ATATAATGTGTATAATCAGAGTGCCTCTTATACATACTTTATAGAATAAAGGAACATTTTGACAGATGAG
    GTTATCCCTCGGAGTAGCGTAATCACACAATAACATTTAGAACTTAAATTGGCTACAGGACATTTTATTA
    GCTTTCTATCCAGCATCTGGTCCAAACGATGGGACTCTCTGCAACTATCATTCCAGAAATGGTCTTGGAG
    GTGGCCAGAATCATTGACCATATTTTTATTTGGTTCAAGAAGACATCGCTCTGGCATCCCCAGTTCAGTG
    AACTGGTACAATGTGGTCCCTCTCAATATTTAAAAATATAATTTGTAACAGTGCTTACCATTCACCTCCC
    AAAGCCAAGGAACTTGAGTGAGCTTCCTTGGCAAGCCTCCCATTGCCTTTCTGCATCAATGTGTTTGTTA
    CCAAATAGCAGAAATTTCGCTTAGAAGGGGAAAACTTCAGCTTTCCAAAAGCTAGTAAACATGTTTCAAA
    GAAAAATAAGGTCAGGAGAAAAAGAATAATGCCTACAGATTATCCTTCAGATGCTGGCTAGAATCCCCTT
    TGACTTCTAGCCATAAGCTGGCCACATTGGACATCTTGGTCACTGCAGAATTTTAAAAGGCAAACTTCTC
    AGAACAGATGTGCACATCTTAATTTGGTGTCTGTAAGTATCAACCATTTCTTGATCAAGATAAGGAAGCA
    ACACTGATACTGAGAGAGAGGTCATATGTCCAATAGTTGCCTTTCTTCTCTTAGGCAGCTCTGCACTTCA
    TGTTCAGTTTTTTAAAAATAGACTGTAGTATCCTTTCATTGGAGAATTTACAAAAATATCATCTACAGCT
    CAAAAGTCCCACTAACGGCTTATATGAACAGAAAGTACTGTGTAGCCCAGGAGTTTATTTAGCAAGATAA
    ATAGTGGTAATTTCTTAATCATTCCCCTTTCCTTTGCTTTACCTTCTGGCAGATGCTTAGCTACTTCTTT
    GGCTACCTCATAATTTGTATGGGAATGAACATGAATTAGGGAACTTCAAATAGTGCGTAGACTTTTCCCT
    ACTTACCATTGGGTTCAATTGATGTAGACTGTTAGAGCAAGTATACTCAATCAACTTGCTGATATTTTAG
    TAGTTAACAGCTTCCGAGCCTATCATGCAATTTGGAGTCTGTCAATGAATATAGCAATCGGTGAAGCATT
    ACTGTACGAAGTCTGTTTTCAGGCTTTGGGTCAAGCTGGTTTTATACCAAATTTCACTCTACAATGCATA
    TTCTAATGAAGCTACTTTATATAAATTGGAGAGCTTATAAAATGCAGAACATTTCTATCCTATCCTACCA
    AATATTTATCCTTCTCTGTCCTCTATTCTCTTACTCTCCTCTCTCCCTTTTTCCTTCCCTTTATTCCCTT
    GAAAAAAGAGAATCTGTGGGAAATAGGCAGATATAGCTTTTTAAAATATAAAGTACTTGGGATTTTGCAT
    TATTTTTCTTAATATCTATTTACTAAGTATGTAATTTAATATACATTAATTATTTTTTGAAACTCTTGTT
    AGTGGGAAGAATATGGTAAATTTTTTGTTAAATAAAATAGACCCTTATGTTTAGCATTTTGTTTTTAGAG
    AACTATTCTGGTACTATCAGAACAAATACATAAAATAACTTCCCATAGAGAACAGGATATAGCAATAATA
    GCTCCTTAGATACTCAGTGGCTTCTGACTCCAATCAAGGTCTTGTTGATATTATATAGTAAAAATAAAAC
    CAAAAATAAATATTATTCAAGTGGCTCTTCTAAGCATGTGAATCATGAAGCACTGAAATATGTATTTTAA
    TGATGATCTTATTTATTCCCATTTTTGCCCTTAGTTAACATTTACTGGTGCTCACCTAGGATTGGCTATT
    CTGAGGGATTGCATAGAAACCAAGCTCCACTTGCTGTCCTTGGGAAGGTTATAACTGAATGCAGCTCTTT
    ATTTGGACTAAAGTGTCAGGATATGCATTAGATTCTCTCCTGAACCAAAAACACAACAGTCATTATCTGT
    GAACCATAATTTAAAAATCTTTCTAGAATAACAACAGCAGACTCCACTCTTGTTTGTCTAAAAGAGCCCT
    ACTGGGTATGGATCATTCTGATGACAGATTTATACAAAATGATTCAAACCAGTAACTTAGTAAAATTGAC
    CTTCGCAAAACCTCACTGGGGGAGTGCCTTGTAGAGCTGTGGGTGGGACTGCACATTCTTTTCCTCTTAG
    TAAAAGATAGGCCCACTTTATTCCAAGAATAACACTTAGCACATAAACTCTTCTTCCAGCTCGTTAGCAG
    CATTAGCACCTTCTGAATTCCACCCTCTCAGAAGAATCCACAGTGTTTGAACAATTTGCATAAAGGTCAG
    CTAGCATCCTGCTGCCAAGCCACTGCATAGCATTTGTGATAAGAAGGACCAACTCTAGGCTCAATATGAA
    GGGATTTAGTTCTGTAAGCAGCAAAAAAGCTTCTTTATCAAGTCATCTTACCTCTAATTCTTTTCCAGTG
    TGCCAACTCCAAAGTCAACATTAAAAATGTAAATGGACCTGTGTAAATATCACAGAGAGCTTTTCCTTAT
    ACATCTCAATGCTGAGAGTTAAAATATTCCCAGGTTAAAATTTTTTTAAAGTACCAATAATAGAGCTAAA
    TACAATGACATTTGCTTTTAAAAGGTGGATATTTTATTTCTGCTTTTTGAAAATACTTATTTAGTATTGA
    CTTGGAAGCCAATTTGGTCCTTTAATAAGTAAAGAAAATAATATGTTTAAAAATGTAAATGTTTTACAAA
    TTTGAAACTTTCATAATTGTATTAATCAGAAAACAAGCACATTGCCATTCTTTGAAACTCATGTTTCTAG
    ACATGACAGCAGTAATAAAAGGATGAAAACAAGTGTCTTCACTAAGCGTATGGCCAATAAATGGGACCCA
    AACGTTCAATCTGTTCAGTTTACCAAGGTTCAGAAATACGTAATTTAGCAGGAAACTATAAATACCAGTG
    CTATCACAGCCACACATACACACACACAGACATAAAATAACCAAACATCTCATTTCTAGGAAAGAGATAA
    CACTAAAGGCATCATAGGTTTAACTGAAATACGTTATATGAAGTTTTACAAAAAGGTCAACAGAAAGCTC
    ATTTGTGAAAACATACTCTCATGGGAGCTTCTTTAACATTAGTTCAGAGGTTAATATATTTCCTGGAGGT
    GTTTTCCTAGAATTGATTGCACTATTGCATGGTAATAACATTTAATTGTTAAGGAAACATTATATATAGG
    TTCAAATTATCCCTTAATGTTGATTTCTCCCCTTTTCCATGGATTTTGATACTAAGAAACAAAATGCTTT
    GAGATTTTGGTAACTATTTTGATTTTGATAAAACATGTTAAAATAGAAGGACATGATATTTTTCTATAGT
    TTCCATCAGGAAGAGTACATCAGAAACTTCTCCATAAGGAAAGAAAACTGACTCTCTCTTGAACTAGTGT
    TGACAAAATACACTAATGTCTTTCTTAATTTTATTTTATTAGGAGAAAAATCAGAATATTAAATTTGCAA
    ACTTTTGAACAGCAGTAATAGCTCCTTAGACACTCAGTATCTTTCTTCCCTATCTTTCAAGCACATTTAA
    TTTCTTTCCCCTGGTATTTGTTTGCTTTGTGTTTTTTCAATATTTTGTTTGCTAAAGAACAATAACAACA
    ACAAAGCTGGTCCAGCCCTGACACCTACTTTTGCTTTTTTTCTTTCTTTCTTTTAATTTGTTGAACTATA
    GGTTTCTTTCTGAGATGTATTTTTCATTCTTCCAATAATGCTCTCTTTTTCATTTCAAAACCATTACCAC
    TTTCAATATGTAATTAACATCCTCATTCATCAGAAAGCTGGTAAGTCCACACAGCATTTGTGCAGTATCC
    CTTCTGTGTAAAATGTTAAGGCTTTCAGATGAAAGAAAAAAGAACTTCCTGCAAAAGATCAAAAGCATCA
    TACTAAATAAAATGATGACAATATGTGCCTTGATTTTTCTCTCAATGGAGGTTCAACATTGACATTTAAG
    ATGTAAAAAAAATTACTTTGATGGTTTAATTAAGAATAATAAGTCAAATATCACATGTATGTAGTTCTTT
    TGGATGACCGAATACCTTAAAATGAACTAAATAACTGAAATAAAGTGTTAAAATGTTAACAGCGTTGAAG
    TTTTTAAAATTATAATTATCAAATGCACAATGTTCTTTTACTATGCCAAATGTTGCCTACACTGATTACA
    TGATTGTCACAGTTTAAGTGAATTTCTACTATGGATCTTTATTTTCCCCAATGTTTGGATCATCCTCTCA
    GATAAGAATTGTCAGTATTGCACCTCAAGAAAGAAGAAAAAATAAGAATGTAAATTTTTAAAAGCTAGCA
    TTAAAAGTAAAGAGCAGTACAATAAAAATCACTTAAAATAGAGAAAGGCAACTACTGAGTAAGAAGAAAA
    GATAATTTCTGTAAAAGCTAAATTTATGCACATTACAAAAAGTAGTCAAGTCAGTCTTCCATTGTGACTT
    CAGGAATTCAAATGCAAGTTGTTGGCAAAATATATATATACACACACACACACATACACACACATATATG
    TACATACATATATATATAGAGAGAGAGAGATAGATTTTTTTTTTTTGAGACAGAGTTTCGCTCTTGTTGC
    CCAGGCTGGAGTGCAATGGAATGATCTTGGCTCACCGCAACCTCCGCCTCCAGGGTTCAAGTGATTCTCC
    TGCCTCAACCTCCTGAGTAGCTGGAATTACAGGTGCCCACTACCATGCCTGGCTAGTTTTTGTATTTTTA
    GTAGAGACAGGGTTTCTCCATGTTGGTCAGGCTGATCTCGAACTCCCAACCTCAGATGATCCTCCCGCCT
    CCACCTCCCAAAGTACTGGAATTACAATGGCGTGAGCCACCACAAGATATTTTTAAAGCCCATTTGTCTA
    TAAAAGAAAACTCTTGGACAAGGAGCTTTGTGTTTTATAATTGTATTACGTGCCTGCTTCCTTACCAAGT
    GCCCTCCATAACACTAAGTAAATTTATATTTATCTAGCCTCTGAGTGACATATCTGTGTGTAATGGAATT
    ATTTGCAGAATTTAATAGCCTTTTTTATTTTCGCATGAGAATTTTTCAAAAACTATCAGGGTCTAGTTTT
    ATCATACATTTACTAAGTTACTACATATTGGTGGATATTGACGTTTATTCCTGGGAATCTAATTTTGCAA
    ACAATTTGGAGCCATTCAGTCATAAATTCATGTCAACAATAAGTCTTGCTGCCGCTTGTGTTTCATAACT
    ACGCTTGCTTTCCTTCAAAATATACCAAGTGTGTAATATAAATAAAGCCCATATCAATATAAAAAAAAAA
    AAAAAAAAA

    Композиционный код 6:

    5,3,5,5,3,5,5,3,4,4,1,1,3,2,3,5,5,2,5,3,3,5,5,3,5,5,3,5,5,2,3,2,5,3,5,5,3,5,3,3,4,4,4,1,1,1,2,5,5,5,
    2,3,5,2,1,1,1,1,1,1,1,1,1,1,1,4,4,2,5,5,2,3,3,5,3,4,4,4,3,5,5,5,3,5,5,2,5,3,5,3,3,1,1,4,1,3,2,1,4,1,
    1,4,1,6,1,2,5,5,3,5,5,3,1,4,1,4,2,1,1,1,1,1,3,3,2,2,5,2,4,4,1,4,4,4,4,4,4,4,3,5,5,2,5,2,1,1,1,4,2,5,
    5,3,1,1,1,1,4,1,4,1,3,3,4,4,4,3,2,5,5,3,3,5,5,5,2,4,4,4,1,1,2,4,4,4,3,5,5,3,3,4,4,4,3,5,5,3,1,4,4,1,
    1,4,1,1,4,1,1,1,4,3,5,2,2,5,5,5,2,5,5,5,2,4,1,1,4,3,1,1,1,1,4,1,1,3,5,3,1,1,4,1,1,3,1,4,1,4,1,1,4,3,
    4,1,1,1,4,4,1,4,1,3,5,5,5,2,5,2,2,5,2,2,5,2,4,1,4,1,4,1,1,1,1,4,1,3,5,3,5,5,5,3,4,4,4,3,1,4,4,4,1,1,
    3,1,4,1,4,4,1,4,1,1,1,1,1,1,1,2,1,1,1,1,4,1,1,4,1,1,1,1,4,4,3,5,3,2,3,1,1,1,1,4,1,1,3,2,2,5,3,5,2,1,
    1,4,1,3,1,4,6,1,1,3,3,5,5,3,2,5,5,5,3,5,5,2,5,5,3,5,2,2,1,1,1,1,2,1,6,4,4,1,4,3,2,2,5,3,3,5,5,5,3,3,
    5,3,1,1,1,1,1,3,4,4,1,1,2,2,4,1,1,1,3,2,5,5,5,3,1,4,1,6,6,6,6,1,4,1,1,3,2,4,4,1,4,1,2,4,4,4,2,5,5,3,
    3,5,3,5,3,1,4,1,1,1,1,3,3,3,2,5,5,3,1,1,1,1,1,4,1,1,3,3,1,1,4,1,3,5,5,5,3,5,5,3,4,4,1,4,1,3,1,1,1,1,
    3,3,3,5,3,1,1,1,1,1,3,3,5,3,5,5,2,5,3,2,3,2,2,3,2,5,3,3,5,5,5,2,4,4,1,1,6,1,2,5,3,4,4,1,1,4,3,5,3,3,
    3,5,3,5,3,5,3,5,5,5,2,5,3,2,5,3,3,5,3,1,1,1,1,1,3,5,3,5,2,3,2,5,5,2,4,4,4,3,4,4,4,3,3,5,3,5,3,5,3,3,
    5,3,5,5,3,3,5,5,5,3,2,5,3,5,5,2,1,1,1,4,1,1,1,3,3,5,3,1,1,4,4,1,1,1,4,4,3,4,4,4,3,2,2,1,1,1,1,2,5,3,
    4,1,1,1,1,3,5,3,5,3,5,5,2,3,3,5,3,1,1,4,4,4,2,5,2,5,3,3,2,4,1,1,4,1,3,5,5,3,2,3,5,5,3,2,3,3,3,5,5,3,
    3,5,5,5,2,5,5,3,3,5,5,3,5,3,5,5,3,3,5,3,5,3,5,5,5,3,3,5,3,5,3,1,1,1,1,4,2,3,3,5,2,2,5,2,1,1,1,1,1,1,
    2,2,1,1,1,4,1,3,3,5,3,5,5,3,3,3,5,2,5,2,5,5,5,2,3,3,5,5,3,5,3,5,3,3,3,4,4,4,2,5,5,3,5,3,3,5,3,3,5,3,
    5,5,3,4,1,4,1,3,5,3,5,3,3,5,5,2,5,3,5,5,5,2,2,4,1,1,1,1,4,1,1,3,5,5,5,2,3,5,2,3,2,3,5,2,5,3,5,5,5,2,
    5,2,5,3,3,5,5,2,5,2,5,3,1,1,1,1,3,5,5,5,2,1,4,4,1,3,3,5,3,1,1,1,1,3,3,3,3,3,5,3,5,5,3,3,3,4,4,4,3,3,
    2,4,1,1,1,1,1,1,4,3,5,2,3,5,3,5,3,2,3,5,3,5,3,5,5,3,1,4,1,1,1,2,3,1,1,1,1,1,1,1,3,3,5,5,5,3,1,1,1,4,
    3,5,2,1,1,1,4,3,3,2,5,3,3,3,5,3,5,3,5,3,5,3,5,2,5,3,3,5,5,5,3,5,3,2,4,4,4,3,2,5,3,1,1,1,1,1,1,2,3,5,
    5,2,3,5,3,5,3,3,4,1,1,1,4,3,3,1,1,1,1,3,5,3,5,3,3,3,4,4,1,1,3,5,3,2,3,5,5,2,5,3,3,3,5,5,2,5,5,3,3,3,
    5,3,5,5,5,3,2,3,5,3,3,3,5,3,3,3,5,3,5,3,3,3,5,5,5,3,5,3,3,3,1,1,6,1,3,5,5,5,3,3,2,3,5,3,5,3,5,5,5,3,
    5,3,2,2,5,5,3,3,3,1,1,1,1,1,1,3,3,2,3,5,5,5,3,3,5,2,5,2,5,3,3,5,3,3,3,5,5,3,5,2,3,5,3,3,3,5,3,3,3,5,
    3,3,5,3,2,3,3,2,1,4,1,1,4,3,3,3,5,5,5,2,3,5,3,2,3,3,5,5,2,2,5,3,3,3,3,3,3,2,2,2,5,3,2,3,3,3,3,1,1,1,
    4,3,3,1,1,1,1,3,2,3,3,5,3,3,2,3,3,3,3,5,3,3,2,2,2,5,3,5,3,2,3,2,5,3,5,2,3,3,5,5,5,3,3,1,1,1,1,1,2,5,
    3,5,5,3,5,3,3,5,5,3,3,5,5,5,2,3,2,3,3,3,3,3,5,3,5,3,2,5,3,1,1,1,1,3,2,5,3,5,5,3,3,3,5,2,5,5,3,5,3,3,
    3,5,5,5,3,5,5,3,5,2,3,3,2,5,3,5,3,3,3,3,3,3,3,5,5,3,3,3,3,5,3,3,5,3,5,5,3,3,3,5,5,5,3,5,5,2,3,5,5,3,
    5,5,3,1,1,1,1,3,5,5,2,5,3,5,5,3,3,3,5,3,3,1,1,1,1,1,3,5,3,3,5,3,3,2,2,3,5,5,5,3,5,3,1,4,1,1,3,2,3,5,
    3,3,3,3,5,5,5,3,5,3,5,3,3,2,2,3,2,3,3,5,3,5,5,3,5,5,5,3,2,3,5,2,2,3,3,3,2,3,5,3,3,5,3,3,3,3,3,3,5,2,
    2,3,5,3,3,5,3,2,3,3,3,3,5,3,3,3,5,2,5,5,5,3,3,5,5,3,3,2,5,3,5,3,3,5,3,5,3,5,5,3,5,5,3,5,5,2,3,3,3,3,
    5,3,3,2,2,3,5,5,2,3,3,5,3,3,4,1,1,4,1,3,5,3,5,5,3,3,5,2,3,5,2,5,5,5,3,3,3,5,3,5,3,3,2,2,5,2,2,5,3,3,
    5,5,5,3,3,3,3,5,5,3,3,1,1,1,1,3,5,5,2,3,5,5,3,5,5,3,5,3,3,4,1,1,4,3,5,3,5,5,3,5,3,2,5,3,1,1,1,1,1,2,
    3,3,3,3,5,3,5,5,3,3,5,3,3,5,5,3,2,3,5,3,5,3,5,2,5,3,5,5,3,5,3,5,5,3,3,5,2,4,1,1,1,1,1,4,3,5,3,3,3,3,
    4,4,4,3,3,3,3,5,5,3,5,3,5,3,3,3,3,1,1,1,4,3,5,3,1,1,1,4,3,3,3,5,3,5,2,5,5,3,5,3,3,5,5,3,3,5,5,3,5,5,
    3,3,5,3,5,5,5,3,3,3,5,3,5,2,3,3,3,1,1,1,1,2,5,3,3,5,5,3,2,5,5,3,3,3,3,3,5,5,3,3,2,5,3,5,3,4,6,1,1,1,
    1,1,3,3,5,5,3,5,5,3,5,2,5,3,5,5,5,3,2,3,5,3,2,5,3,1,1,1,4,1,6,1,2,5,3,2,5,3,5,5,5,3,5,5,3,5,3,3,3,3,
    3,5,5,2,5,5,3,3,3,2,3,3,1,1,4,1,3,1,1,1,1,1,3,5,5,2,3,3,5,3,3,5,5,3,2,5,3,5,3,3,3,5,3,3,5,2,3,3,5,5,
    3,3,2,3,3,3,3,3,2,5,5,3,5,5,5,3,3,3,5,3,5,2,5,5,5,3,3,5,3,3,5,5,5,3,5,5,5,3,3,2,3,3,3,3,3,3,3,3,5,5,
    2,3,3,3,3,2,3,3,5,2,3,5,3,3,2,3,3,5,3,1,1,1,1,3,2,5,3,3,4,1,1,1,2,1,1,1,1,1,2,5,2,4,4,1,4,3,3,5,5,3,
    5,5,3,3,5,3,5,5,2,5,2,1,1,4,4,3,5,5,3,5,5,2,5,5,3,3,5,5,3,3,2,2,3,5,2,3,5,3,3,5,5,5,3,5,5,3,3,3,3,3,
    3,5,5,5,3,1,1,1,1,1,2,3,4,1,1,1,1,6,4,1,3,3,5,3,3,2,2,2,3,2,3,5,5,3,5,5,5,3,5,3,3,5,2,5,5,3,1,1,1,1,
    3,3,5,5,3,5,3,3,3,5,5,3,5,3,5,2,5,2,3,3,5,3,1,1,1,1,1,3,5,5,3,5,3,4,1,6,1,6,4,2,3,5,2,2,5,5,2,5,3,3,
    3,2,5,3,3,5,3,3,3,3,5,5,3,5,5,3,3,5,3,5,3,5,3,5,3,3,5,3,5,3,4,1,4,1,3,5,5,3,1,4,1,1,3,3,3,5,2,5,5,3,
    5,3,2,3,3,5,3,2,3,3,2,2,5,3,4,1,1,1,3,3,3,3,3,2,3,2,1,1,6,1,3,3,3,3,5,3,5,3,5,3,2,3,2,5,5,5,2,3,5,3,
    3,3,5,5,3,5,5,3,5,5,2,5,3,1,1,1,1,3,5,2,5,5,2,3,5,3,5,5,3,5,3,5,5,3,5,3,3,2,2,3,3,5,5,3,3,3,5,5,2,3,
    2,5,5,3,5,3,5,3,5,5,5,3,3,2,5,3,1,1,1,4,1,4,3,2,1,4,6,6,1,3,3,3,5,2,5,3,3,1,1,1,1,2,5,5,3,3,5,2,3,5,
    5,5,3,3,1,4,6,1,3,5,5,3,5,5,2,1,1,1,1,4,2,5,5,3,2,3,5,5,3,5,3,5,3,2,3,3,3,3,3,3,3,5,2,5,5,2,3,3,3,3,
    5,3,3,3,3,3,2,3,5,3,3,3,5,3,3,5,3,3,3,2,4,4,4,3,2,3,3,2,5,3,5,3,2,5,3,2,5,3,5,3,5,3,1,1,1,1,3,1,4,1,
    1,3,2,3,5,5,5,3,5,2,3,3,3,5,3,5,3,5,3,1,1,1,4,3,3,5,3,3,5,3,4,4,4,3,5,5,3,5,5,5,3,3,5,2,3,3,3,3,3,5,
    2,2,1,6,1,1,4,3,5,3,5,5,2,3,3,6,1,1,6,2,3,5,3,3,3,3,5,3,3,3,2,1,4,1,6,3,5,5,3,5,3,3,5,5,3,3,3,5,5,3,
    5,3,3,5,5,3,5,2,3,5,5,5,3,3,2,5,5,3,3,2,5,3,5,3,2,3,5,5,5,3,5,3,1,4,4,1,4,1,4,3,3,2,3,5,5,3,5,3,5,5,
    5,3,5,3,3,4,1,1,1,1,3,3,5,2,1,1,6,1,2,5,5,5,2,5,3,5,3,4,4,4,2,5,5,2,3,3,3,5,5,5,3,5,3,3,1,4,1,1,6,1,
    3,3,2,5,5,5,3,3,3,3,3,3,5,5,3,2,3,5,3,3,2,2,5,5,5,2,3,3,5,5,5,2,5,3,5,3,2,5,5,2,5,3,5,5,5,3,5,2,5,2,
    5,2,3,1,6,1,1,4,1,1,3,3,5,3,5,5,3,1,1,1,1,1,3,3,5,2,3,3,2,1,1,1,1,1,1,1,4,3,3,3,3,5,5,3,3,3,3,5,5,3,
    3,3,5,3,3,2,3,2,3,2,5,2,3,3,1,1,1,1,1,1,1,3,3,5,3,1,1,1,1,1,4,1,4,1,2,5,5,3,3,5,5,5,3,5,5,3,5,5,2,3,
    5,3,3,5,3,3,5,5,3,2,2,3,2,5,5,2,5,2,5,5,5,3,5,5,3,2,5,3,5,3,3,1,1,4,1,3,1,1,4,4,2,2,5,5,5,3,3,5,5,5,
    2,5,3,3,2,3,3,4,1,1,1,1,1,1,1,3,3,2,3,5,5,5,2,5,3,3,3,3,3,3,5,3,2,1,1,6,1,1,3,3,1,4,1,1,1,4,1,1,1,2,
    5,3,5,5,3,5,3,3,5,5,2,3,5,2,5,3,2,5,2,5,5,5,2,3,3,3,2,5,5,2,3,1,1,1,1,2,5,3,3,2,5,3,5,5,2,2,1,1,1,1,
    3,5,3,5,3,5,2,3,5,5,2,5,5,3,3,4,1,4,4,2,5,3,5,2,2,3,5,3,4,4,4,2,1,1,1,1,1,3,3,3,5,5,3,5,3,5,5,2,5,3,
    5,5,3,3,2,5,3,3,5,3,1,1,1,1,3,6,1,4,1,3,5,5,3,5,5,5,3,3,2,5,5,2,5,5,3,5,3,3,3,3,3,2,3,3,3,2,3,3,3,3,
    4,4,4,3,3,5,5,3,5,3,5,5,3,5,5,5,3,4,4,4,3,2,5,3,2,3,3,5,3,3,5,5,3,3,2,5,3,2,3,3,5,5,3,5,5,3,3,2,5,3,
    3,3,3,3,3,5,5,3,3,5,2,5,2,3,5,5,3,3,2,3,5,2,3,3,5,3,2,2,5,3,5,3,3,5,3,5,3,5,3,5,3,2,3,3,2,3,3,5,5,2,
    2,2,5,3,5,5,3,2,5,2,3,5,3,2,3,5,5,3,2,5,3,5,3,5,3,5,3,2,3,3,5,3,3,3,5,5,5,3,3,5,5,3,3,2,5,5,3,1,1,1,
    1,1,4,1,1,3,1,1,1,1,2,5,2,5,2,5,5,3,3,3,3,5,3,2,2,2,1,1,1,1,3,1,4,1,1,1,1,1,1,1,1,3,5,3,2,3,2,3,1,1,
    1,1,1,1,1,1,1,1,1,3,2,1,1,4,1,3,5,5,2,4,4,4,2,5,3,1,1,1,1,1,3,5,3,2,4,4,6,1,1,1,1,3,3,1,1,4,1,3,5,5,
    3,1,1,1,1,3,1,1,6,4,1,2,5,5,3,5,3,5,5,2,3,3,1,1,4,1,2,3,5,5,3,5,3,5,5,5,2,3,3,5,3,2,5,3,3,3,3,3,3,2,
    5,3,5,5,3,5,3,3,3,3,3,5,3,2,1,4,1,1,1,3,5,3,5,3,5,3,3,3,3,5,5,3,2,3,3,5,2,3,1,1,1,1,3,5,5,3,3,3,3,3,
    5,5,2,5,2,5,3,5,3,3,3,3,3,3,3,3,3,5,3,2,5,5,2,3,2,3,3,3,3,5,3,5,3,5,5,3,5,5,3,2,5,5,2,3,5,3,3,3,5,5,
    5,3,3,5,3,3,3,5,5,3,5,3,3,3,2,3,5,3,5,5,2,5,5,3,3,3,3,5,3,3,3,3,5,5,3,2,3,5,5,3,5,3,3,3,6,1,1,4,3,3,
    5,2,3,3,4,1,1,1,1,2,5,3,2,5,3,3,3,5,5,3,3,5,2,3,3,3,3,5,3,5,3,5,5,3,5,5,5,3,3,5,3,3,5,3,5,3,3,2,5,3,
    5,3,3,5,3,5,3,3,5,3,5,5,3,3,5,2,3,3,1,1,1,1,1,3,5,5,2,2,5,3,3,3,3,3,3,5,5,3,3,3,4,4,4,3,3,5,5,5,2,3,
    5,2,5,3,5,2,2,3,5,3,3,5,5,3,5,5,2,3,3,5,3,3,3,5,2,3,3,3,5,3,3,3,5,3,1,1,1,1,3,5,2,3,3,3,2,5,3,2,5,3,
    5,3,3,2,3,3,3,5,3,3,2,2,3,1,1,6,1,3,5,5,2,2,5,5,2,5,3,5,3,5,5,3,3,5,2,5,5,3,3,3,3,5,3,2,2,3,3,2,5,3,
    5,3,5,5,5,3,3,5,3,3,3,3,2,3,5,5,3,3,5,2,3,3,3,5,3,3,3,5,5,3,5,2,5,2,3,5,5,3,3,2,6,1,1,1,2,2,3,3,3,2,
    3,3,5,3,3,5,3,2,3,5,3,5,5,3,3,5,5,3,5,5,2,5,5,2,5,3,5,5,5,3,5,3,3,5,3,5,5,3,3,5,3,3,5,3,5,5,5,3,2,3,
    3,3,3,3,3,2,5,3,3,5,5,5,3,3,3,2,5,3,2,3,3,3,2,3,3,5,5,3,5,3,5,3,2,5,2,5,5,2,3,5,2,3,5,2,5,5,3,3,3,5,
    3,3,3,5,5,3,3,2,3,3,3,5,5,3,2,3,5,5,3,1,1,1,1,2,5,5,3,1,1,1,1,1,3,3,3,5,5,3,3,5,3,3,3,3,1,1,1,1,3,2,
    3,2,3,3,5,3,5,3,2,2,5,3,3,5,3,3,5,3,3,1,1,1,1,2,3,5,2,2,5,3,3,5,5,3,5,5,3,2,5,5,5,3,3,5,3,3,3,5,5,5,
    3,3,3,3,5,3,5,3,5,3,1,1,1,1,6,3,5,5,5,3,5,5,5,2,3,3,5,2,5,5,5,3,5,2,3,2,3,3,5,5,3,3,5,5,3,2,5,3,2,3,
    3,2,5,3,5,5,5,3,3,3,2,3,5,5,3,3,3,3,5,5,3,5,5,2,2,5,3,5,5,3,5,3,3,3,5,3,5,5,5,3,3,2,2,3,5,3,2,5,3,5,
    2,5,5,3,3,5,3,3,5,3,2,5,3,3,2,5,5,2,3,3,2,3,5,3,3,3,3,5,5,5,3,3,5,2,5,5,3,2,3,5,3,5,3,3,2,5,3,5,3,3,
    5,5,3,3,3,5,3,3,5,3,3,3,3,3,3,5,2,3,5,5,2,5,3,3,3,2,5,3,3,5,3,3,2,3,3,5,3,2,3,3,5,5,2,3,3,3,2,5,3,3,
    3,3,5,3,5,5,3,5,2,3,2,5,5,3,3,3,5,2,3,5,5,3,5,3,5,3,5,3,3,5,5,3,3,3,3,5,3,2,3,2,5,3,5,5,2,5,3,2,2,3,
    5,3,3,5,5,3,3,3,5,5,3,5,3,2,1,1,1,1,1,2,3,3,3,3,3,3,5,3,3,3,3,3,2,3,5,3,3,5,3,5,3,3,3,2,5,3,3,2,3,5,
    5,5,3,3,3,5,2,3,5,5,3,3,5,3,5,5,5,2,3,5,3,5,3,3,5,2,5,3,3,5,3,3,2,3,3,5,3,5,5,3,2,3,3,5,5,3,3,3,2,2,
    5,3,5,3,5,3,5,3,1,1,1,1,3,5,2,2,5,3,5,3,3,2,5,3,3,3,3,3,3,2,2,2,2,5,5,3,3,3,3,2,3,1,1,1,1,2,5,5,3,5,
    5,2,3,3,5,3,5,3,3,5,3,5,3,2,3,5,5,5,2,3,3,4,4,4,3,1,1,1,1,3,4,1,1,1,2,5,3,5,3,5,5,5,2,5,2,3,3,5,5,3,
    5,3,5,5,2,5,3,3,4,4,4,3,2,2,3,2,3,3,3,5,5,3,5,3,3,5,5,3,3,5,2,3,5,2,1,1,1,1,3,3,3,5,5,2,5,3,5,3,3,3,
    5,5,5,3,5,5,3,3,3,3,5,3,5,5,3,5,5,3,3,5,5,3,5,5,2,3,1,1,1,1,3,5,3,5,2,3,2,5,2,2,3,3,6,1,6,1,4,3,3,3,
    5,3,5,3,5,3,2,3,5,3,3,5,3,5,3,3,5,5,3,3,3,3,5,3,5,3,3,3,3,3,5,3,5,3,5,3,4,4,4,3,3,3,3,5,3,3,3,3,3,3,
    3,2,5,3,5,5,2,3,5,5,3,3,5,5,3,3,5,3,3,5,3,3,3,3,3,2,3,5,3,3,2,5,5,3,5,2,3,5,5,5,3,5,3,3,5,5,2,3,5,5,
    2,1,1,1,1,1,1,3,3,5,5,3,3,4,4,4,3,5,3,5,5,2,5,3,3,2,5,3,2,3,5,3,3,2,3,2,3,3,3,2,2,5,3,3,5,5,5,3,5,5,
    5,2,5,2,5,2,5,2,3,5,2,5,5,2,3,2,2,5,3,1,1,1,1,3,3,5,3,5,5,3,5,3,3,3,3,3,3,3,3,3,5,3,3,3,5,5,3,3,3,5,
    5,2,3,3,3,2,3,3,5,5,3,2,3,1,4,1,4,3,5,5,3,5,5,5,3,5,5,2,2,2,3,3,3,5,2,5,3,2,3,5,5,3,3,5,3,3,3,3,5,5,
    3,3,2,5,3,5,2,2,3,5,3,5,3,5,3,3,3,5,3,3,3,3,3,3,2,3,5,3,3,5,2,5,3,3,3,2,3,1,1,1,1,3,2,2,3,3,3,2,5,2,
    5,3,3,5,3,1,1,1,1,3,5,3,3,2,2,5,3,5,3,3,3,3,3,5,5,3,3,5,3,3,3,3,2,5,3,5,2,2,2,2,3,3,5,2,5,3,5,3,3,5,
    3,3,2,5,2,3,3,5,3,5,5,2,3,3,5,3,5,3,3,3,3,3,3,5,5,3,2,2,2,2,2,1,4,1,1,1,1,1,2,3,5,3,3,5,3,3,3,3,3,5,
    5,5,3,5,3,3,3,5,5,3,3,2,5,5,3,5,5,3,3,3,3,5,3,5,3,5,3,5,3,5,5,3,2,5,2,5,5,3,5,5,2,3,2,5,5,3,3,2,2,5,
    3,5,3,3,5,3,5,3,2,3,3,3,3,1,1,1,4,3,5,5,3,5,5,2,2,3,3,5,5,2,2,3,5,5,3,3,5,2,5,5,3,3,3,5,3,3,3,3,3,3,
    3,5,3,3,3,3,3,5,3,3,5,2,3,5,2,3,5,5,5,3,5,5,5,3,5,3,3,5,5,5,2,3,3,2,5,3,5,3,3,5,5,3,3,3,3,3,3,2,3,5,
    3,5,2,5,5,3,5,3,5,3,3,5,2,5,5,3,3,3,3,5,3,3,3,3,3,2,2,5,5,3,3,5,5,3,3,1,1,1,1,2,3,5,3,3,5,3,5,5,2,3,
    5,5,3,3,5,3,3,3,3,3,3,3,5,3,3,3,3,5,5,5,3,3,3,5,3,3,5,3,5,2,3,3,5,5,3,3,5,2,3,3,2,3,3,3,3,5,5,3,2,3,
    3,3,3,5,3,3,2,5,5,3,5,3,5,3,1,1,1,1,2,3,3,2,3,2,5,2,5,2,5,2,5,2,3,2,3,2,3,2,3,3,5,3,5,2,3,3,3,3,5,3,
    5,3,5,3,3,3,5,5,3,2,5,3,5,3,3,3,5,2,5,3,3,5,3,2,4,1,1,1,1,1,1,1,1,1,4,3,5,5,3,5,5,5,2,2,2,5,5,3,3,3,
    3,3,3,3,3,5,5,3,3,2,3,5,2,5,5,3,2,3,5,5,5,3,1,1,1,1,1,1,1,2,5,5,5,3,5,3,1,4,1,1,1,1,2,3,3,5,5,3,3,2,
    5,5,3,3,3,2,3,2,3,5,3,3,2,3,2,3,3,5,5,5,3,5,5,5,3,2,5,5,5,2,3,3,3,3,3,1,1,1,4,2,3,5,3,2,5,3,3,3,2,3,
    3,3,5,3,3,3,3,5,5,3,3,3,3,3,2,2,5,3,3,3,5,2,3,3,2,3,5,5,2,5,5,3,3,5,3,3,5,5,3,3,3,3,2,5,3,5,5,2,5,3,
    3,3,5,5,2,2,2,3,3,3,5,3,3,3,2,5,2,5,5,3,5,5,3,2,5,3,5,3,3,2,3,3,5,3,5,3,2,3,3,3,3,3,

    Вторичная структура (Пикотех-2017) весит около 6 мегабайт в стандарте PNG: https://cloud.mail.ru/public/KKjH/goMgmMGAn

    На яндекс-фотки не грузится. Но самый интересный фрагмент удалось вырезать в программе Paint:



    Сиреневым цветом отмечен виток необычной метиониновой спирали. В отличие от альфа-спирали у неё более длинный шаг. Метиониновая спираль отличается от обычной альфа-спирали примерно как резьба с более крупным шагом от резьбы с менее крупным шагом:


    Шаг метиониновой спирали примерно на 25% крупнее шага обычной альфа-спирали. При этом на один виток приходится тоже 3.6...3.7 аминокислотных остатка Met.

     



    Ещё один интересный участок этого белка 3916...4164. Он содержит все типы композиционных кодов: 1,2,3,4, но ... не содержит ни одного витка спирали! Интересно оценить вероятность случайной комбинации композиционных кодов такого типа. Напомню, что спираль возникает при трёхкратном (или более) повторении кодов 1, 4 или их комбинации. При этом третий код должен быть "4", либо спиральных кодов (1,4), идущих подряд, должно быть больше 3.

     

     




    Белковая молекула кончается витком полилизиновой пи-спирали, похожей на винт Архимеда.