Перевести страницу

Пикотехнология вкратце

Подписаться на RSS

Популярные теги Все теги

Уточнение 2D структур некоторых G-белков, взятых из базы NCBI, методом Пикотех

2017.12.05 17:53:30



    2D диаграммы Пикотех белковых структур, исследованных методом РСА, версия 2017 года 6var.




    СТРУКТУРА ДИАГРАММЫ ПИКОТЕХ 


     

    СОКРАЩЁННАЯ ДИАГРАММА
    Красный - альфа-спираль.
    Оранжевый - 310-спираль.
    Розовый - одиночный код альфа/310 спиралей.
    Голубой - пи-спираль.
    Зеленый - бета-спираль.
    Сиреневый - метиониновая спираль. У неё более крупный шаг "резьбы", чем у обычной альфа-спирали.
    Черный в сокращённом представлении и белый в развернутом означают либо неизвестный код, либо конец трансляции.
    Циклическое повторение цветов - программная спираль.

    ПОЛНАЯ ДИАГРАММА
    Содержание столбцов
    1 - порядковый номер аминокислотного остатка в белковой молекуле
    2 - триплетный код
    3 - однобуквенный код аминокислотного остатка
    4 - трёхбуквенное обозначение аминокислотного остатка
    5 - упрощённый композиционный код
    6 - графическая интерпретация упрощенного композиционного кода
    7 - композиционный код
    8 - графическая интерпретация композиционного кода
    9 - нота, которая звучит при установке данной аминокислоты в растущую белковую цепь
    10 - графическое изображение ноты (или ударного инструмента)
    Для новой версии Пикотех 2018 разработан Композиционный код 7var
    https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae92_83cc91e_orig.jpg

    Программные спирали - повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).


    1111111111111111111 - прямая альфа-спираль
    4444444444444444444 - прямая 310-спираль
    3333333333333333333 - прямая пи-спираль
    2222222222222222222 - прямая бета-спираль
    232323 - программная 23-спираль
    141414 - программная 14-спираль











    1.
    https://www.ncbi.nlm.nih.gov/Structure/ … p;uid=5TUD

    Structural insights into the extracellular recognition of the human serotonin 2B receptor by an antibody

    Ishchenko A, Wacker D, Kapoor M, Zhang A, Han GW, Basu S, Patel N, Messerschmidt M, Weierstall U, Liu W, Katritch V, Roth BL, Stevens RC, Cherezov V

    https://img-fotki.yandex.ru/get/880375/249950893.0/0_16a3b7_7315a46a_orig.png

    https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

    >ENA|CAA54513|CAA54513.1 Homo sapiens (human) 5-HT2B serotonin receptor 
    ATGGCTCTCTCTTACAGAGTGTCTGAACTTCAAAGCACAATTCCTGAGCACATTTTGCAG
    AGCACCTTTGTTCACGTTATCTCTTCTAACTGGTCTGGATTACAGACAGAATCAATACCA
    GAGGAAATGAAACAGATTGTTGAGGAACAGGGAAATAAACTGCACTGGGCAGCTCTTCTG
    ATACTCATGGTGATAATACCCACAATTGGTGGAAATACCCTTGTTATTCTGGCTGTTTCA
    CTGGAGAAGAAGCTGCAGTATGCTACTAATTACTTTCTAATGTCCTTGGCGGTGGCTGAT
    TTGCTGGTTGGATTGTTTGTGATGCCAATTGCCCTCTTGACAATAATGTTTGAGGCTATG
    TGGCCCCTCCCACTTGTTCTATGTCCTGCCTGGTTATTTCTTGACGTTCTCTTTTCAACC
    GCATCCATCATGCATCTCTGTGCCATTTCAGTGGATCGTTACATAGCCATCAAAAAGCCA
    ATCCAGGCCAATCAATATAACTCACGGGCTACAGCATTCATCAAGATTACAGTGGTGTGG
    TTAATTTCAATAGGCATTGCCATTCCAGTCCCTATTAAAGGGATAGAGACTGATGTGGAC
    AACCCAAACAATATCACTTGTGTGCTGACAAAGGAACGTTTTGGCGATTTCATGCTCTTT
    GGCTCACTGGCTGCCTTCTTCACACCTCTTGCAATTATGATTGTCACCTACTTTCTCACT
    ATCCATGCTTTACAGAAGAAGGCTTACTTAGTCAAAAACAAGCCACCTCAACGCCTAACA
    TGGTTGACTGTGTCTACAGTTTTCCAAAGGGATGAAACACCTTGCTCGTCACCGGAAAAG
    GTGGCAATGCTGGATGGTTCTCGAAAGGACAAGGCTCTGCCCAACTCAGGTGATGAAACA
    CTTATGCGAAGAACATCCACAATTGGGAAAAAGTCAGTGCAGACCATTTCCAACGAACAG
    AGAGCCTCAAAGGTCCTAGGGATTGTGTTTTTCCTCTTTTTGCTTATGTGGTGTCCCTTC
    TTTATTACAAATATAACTTTAGTTTTATGTGATTCCTGTAACCAAACTACTCTCCAAATG
    CTCCTGGAGATATTTGTGTGGATAGGCTATGTTTCCTCAGGAGTGAATCCTTTGGTCTAC
    ACCCTCTTCAATAAGACATTTCGGGATGCATTTGGCCGATATATCACCTGCAATTACCGG
    GCCACAAAGTCAGTAAAAACTCTCAGAAAACGCTCCAGTAAGATCTACTTCCGGAATCCA
    ATGGCAGAGAACTCTAAGTTTTTCAAGAAACATGGAATTCGAAATGGGATTAACCCTGCC
    ATGTACCAGAGTCCAATGAGGCTCCGAAGTTCAACCATTCAGTCTTCATCAATCATTCTA
    CTAGATACGCTTCTCCTCACTGAAAATGAAGGTGACAAAACTGAAGAGCAAGTTAGTTAT
    GTATAG

    http://nanoworld.org.ru/post/96477/#p96477
    Программа Пикотех показывает следующую детализированную структуру.
    Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
    431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.

    https://img-fotki.yandex.ru/get/893753/249950893.1/0_16aff1_b0049741_orig.png

    https://img-fotki.yandex.ru/get/510105/249950893.1/0_16aff0_89b162aa_orig.png









    2. 
    https://www.ncbi.nlm.nih.gov/Structure/pdb/5V56

    Crystal structure of a multi-domain human smoothened receptor in complex with a super stabilizing ligand

    Zhang X, Zhao F, Wu Y, Yang J, Han GW, Zhao S, Ishchenko A, Ye L, Lin X, Ding K, Dharmarajan V, Griffin PR, Gati C, Nelson G, Hunter MS, Hanson MA, Cherezov V, Stevens RC, Tan W, Tao H, Xu F

    https://img-fotki.yandex.ru/get/896238/249950893.1/0_16afce_af6cf2b8_orig.png

    http://www.rcsb.org/pdb/explore/explore … ureId=5V56
    https://www.ebi.ac.uk/ena/data/view/AAA … play=fasta

    >ENA|AAA23367|AAA23367.1 Desulfovibrio vulgaris hypothetical protein 
    ATGCCCAAAGCCCTCATCGTCTACGGTTCCACCACAGGCAACACGGAATACACCGCCGAA
    ACCATCGCACGTGAACTTGCCGATGCAGGGTACGAAGTCGATAGCCGGGACGCGGCCTCT
    GTCGAGGCTGGCGGTCTCTTCGAAGGCTTCGACCTCGTCCTTCTCGGATGCTCGACGTGG
    GGTGACGACTCCATCGAACTGCAGGACGACTTCATTCCCCTTTTCGACTCCCTCGAAGAG
    ACGGGGGCGCAGGGCCGCAAGGTGGCCTGCTTCGGCTGCGGCGACAGTTCCTACGAGTAC
    TTCTGCGGGGCTGTCGACGCCATCGAAGAGAAGCTCAAGAACCTCGGTGCCGAAATCGTT
    CAGGACGGTCTTCGCATCGATGGCGACCCCCGCGCCGCCCGGGACGACATCGTCGGCTGG
    GCGCATGACGTGAGGGGCGCCATCTAG

    http://nanoworld.org.ru/post/96494/#p96494
    Результаты программы Пикотех

    4-8 - альфа-спираль
    49-53 - альфа-спираль
    57-60 - альфа-спираль
    62-65 - альфа-спираль
    67-71 - альфа-спираль
    75-78 - альфа-спираль
    80-95 - альфа-спираль
    97-103 - альфа-спираль
    105-108 - альфа-спираль
    110-115 - альфа-спираль
    115-121 - программная 35-спираль
    120-127 - программная 3355-спираль
    128-141 - альфа-спираль
    143-148 - альфа-спираль

    https://img-fotki.yandex.ru/get/877700/249950893.1/0_16afc9_75560fe6_orig.png

    https://img-fotki.yandex.ru/get/477847/249950893.1/0_16afeb_a12b3edb_orig.png










    3.
    https://www.ncbi.nlm.nih.gov/Structure/pdb/5W0P

    Identification of Phosphorylation Codes for Arrestin Recruitment by G Protein-Coupled Receptors

    Zhou XE, He Y, de Waal PW, Gao X, Kang Y, Van Eps N, Yin Y, Pal K, Goswami D, White TA, Barty A, Latorraca NR, Chapman HN, Hubbell WL, Dror RO, Stevens RC, Cherezov V, Gurevich VV, Griffin PR, Ernst OP, Melcher K, Xu HE

    https://img-fotki.yandex.ru/get/476913/249950893.0/0_16a3b9_61f34840_orig.png

    https://www.ebi.ac.uk/ena/data/view/CAD … play=fasta

    >ENA|CAD97623|CAD97623.1 Homo sapiens (human) hypothetical protein 
    ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTA
    CGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTG
    GCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTAC
    GTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCC
    GTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCAT
    GGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGC
    GGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGT
    AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACC
    TGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCC
    GAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAAC
    GAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTT
    TTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCA
    GCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCT
    TTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGC
    TCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATC
    TACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACC
    ATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACG
    GAGACGAGCCAGGTGGCCCCGGCCTAA

    http://nanoworld.org.ru/post/96490/#p96490
    Программа Пикотех показывает

    8-14 - альфа-спираль.
    21-26 - альфа-спираль.
    28-31 - альфа-спираль.
    35-44 - альфа-спираль.
    46-70 - 310-альфа-спираль.
    72-78 - альфа-спираль.
    83-87 - альфа-спираль.
    90-97 - альфа-спираль.
    102-107 - альфа-спираль.
    112-115 - альфа-спираль.
    117-120 - альфа-спираль.
    124-139 - альфа-спираль.
    141-151 - альфа-спираль.
    153-156 - альфа-спираль.
    158-168 - альфа-спираль.
    172-186 - альфа-спираль.
    189-201 - альфа-спираль.
    204-216 - альфа-спираль.
    215-225 - программная 355-спираль.
    224-233 - альфа-спираль.
    235-239 - альфа-спираль.
    238-248 - программная 255-спираль.
    247-259 - альфа-спираль.
    261-271 - альфа-спираль.
    273-283 - альфа-спираль.
    285-290 - альфа-спираль.
    295-302 - альфа-спираль.
    307-326 - альфа-спираль.
    336-348 - альфа-спираль.

    https://img-fotki.yandex.ru/get/516062/249950893.1/0_16afec_886d280e_orig.png

    https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcc_519f9d05_orig.png













    4.
    https://www.ncbi.nlm.nih.gov/Structure/pdb/5XEZ

    Structure of the full-length glucagon class B G-protein-coupled receptor

    Zhang H, Qiao A, Yang D, Yang L, Dai A, de Graaf C, Reedtz-Runge S, Dharmarajan V, Zhang H, Han GW, Grant TD, Sierra RG, Weierstall U, Nelson G, Liu W, Wu Y, Ma L, Cai X, Lin G, Wu X, Geng Z, Dong Y, Song G, Griffin PR, Lau J, Cherezov V, Yang H, Hanson MA, Stevens RC, Zhao Q, Jiang H, Wang MW, Wu B

    https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcd_1b4a76df_orig.png

    http://www.rcsb.org/pdb/explore/explore … ureId=5XEZ
    http://www.uniprot.org/uniprot/P47871
    https://www.ebi.ac.uk/ena/data/view/AAC … play=fasta

    >ENA|AAC52063|AAC52063.1 Homo sapiens (human) glucagon receptor 
    ATGCCCCCCTGCCAGCCACAGCGACCCCTGCTGCTGTTGCTGCTGCTGCTGGCCTGCCAG
    CCACAGGTCCCCTCCGCTCAGGTGATGGACTTCCTGTTTGAGAAGTGGAAGCTCTACGGT
    GACCAGTGTCACCACAACCTGAGCCTGCTGCCCCCTCCCACGGAGCTGGTGTGCAACAGA
    ACCTTCGACAAGTATTCCTGCTGGCCGGACACCCCCGCCAATACCACGGCCAACATCTCC
    TGCCCCTGGTACCTGCCTTGGCACCACAAAGTGCAACACCGCTTCGTGTTCAAGAGATGC
    GGGCCCGACGGTCAGTGGGTGCGTGGACCCCGGGGGCAGCCTTGGCGTGATGCCTCCCAG
    TGCCAGATGGATGGCGAGGAGATTGAGGTCCAGAAGGAGGTGGCCAAGATGTACAGCAGC
    TTCCAGGTGATGTACACAGTGGGCTACAGCCTGTCCCTGGGGGCGCTGCTCCTCGCCTTG
    GCCATCCTGGGGGGCCTCAGCAAGCTGCACTGCACCCGCAATGCCATCCACGCGAATCTG
    TTTGCGTCCTTCGTGCTGAAAGCCAGCTCCGTGCTGGTCATTGATGGGCTGCTCAGGACC
    CGCTACAGCCAGAAAATTGGCGACGACCTCAGTGTCAGCACCTGGCTCAGTGATGGAGCG
    GTGGCTGGCTGCCGTGTGGCCGCGGTGTTCATGCAATATGGCATCGTGGCCAACTACTGC
    TGGCTGCTGGTGGAGGGCCTGTACCTGCACAACCTGCTGGGCCTGGCCACCCTCCCCGAG
    AGGAGCTTCTTCAGCCTCTACCTGGGCATCGGCTGGGGTGCCCCCATGCTGTTCGTCGTC
    CCCTGGGCAGTGGTCAAGTGTCTGTTCGAGAACGTCCAGTGCTGGACCAGCAATGACAAC
    ATGGGCTTCTGGTGGATCCTGCGGTTCCCCGTCTTCCTGGCCATCCTGATCAACTTCTTC
    ATCTTCGTCCGCATCGTTCAGCTGCTCGTGGCCAAGCTGCGGGCACGGCAGATGCACCAC
    ACAGACTACAAGTTCCGGCTGGCCAAGTCCACGCTGACCCTCATCCCTCTGCTGGGCGTC
    CACGAAGTGGTCTTCGCCTTCGTGACGGACGAGCACGCCCAGGGCACCCTGCGCTCCGCC
    AAGCTCTTCTTCGACCTCTTCCTCAGCTCCTTCCAGGGCCTGCTGGTGGCTGTCCTCTAC
    TGCTTCCTCAACAAGGAGGTGCAGTCGGAGCTGCGGCGGCGTTGGCACCGCTGGCGCCTG
    GGCAAAGTGCTATGGGAGGAGCGGAACACCAGCAACCACAGGGCCTCATCTTCGCCCGGC
    CACGGCCCTCCCAGCAAGGAGCTGCAGTTTGGGAGGGGTGGTGGCAGCCAGGATTCATCT
    GCGGAGACCCCCTTGGCTGGTGGCCTCCCTAGATTGGCTGAGAGCCCCTTCTGA

    http://nanoworld.org.ru/post/96505/#p96505
    Программа Пикотех показывает

    147-173 - наиболее протяженный участок альфа-310-спирали. 
    Весь белок представлен преимущественно участками альфа-310-спиралей.

    https://img-fotki.yandex.ru/get/509739/249950893.1/0_16b0a0_f8fd49ff_orig.png

    https://img-fotki.yandex.ru/get/893904/249950893.1/0_16b0a1_6da31b90_orig.png










    5.
    https://www.ncbi.nlm.nih.gov/pubmed/17962520
    https://www.ncbi.nlm.nih.gov/Structure/ … ;uid=60314

    High-resolution crystal structure of an engineered human beta2-adrenergic G protein-coupled receptor.

    Cherezov V1, Rosenbaum DM, Hanson MA, Rasmussen SG, Thian FS, Kobilka TS, Choi HJ, Kuhn P, Weis WI, Kobilka BK, Stevens RC.

    https://img-fotki.yandex.ru/get/893240/249950893.0/0_16a3b1_d636e8c2_orig.png

    https://www.rcsb.org/pdb/explore/explor … ureId=2RH1

    https://img-fotki.yandex.ru/get/6713/249950893.1/0_16afcf_be7ab3f6_orig.png

    http://www.uniprot.org/uniprot/P00720
    https://www.ebi.ac.uk/ena/data/view/CAA28212

    >ENA|CAA28212|CAA28212.1 Enterobacteria phage T4 hypothetical protein 
    ATGAATATATTTGAAATGTTACGTATAGATGAACGTCTTAGACTTAAAATCTATAAAGAC
    ACAGAAGGCTATTACACTATTGGCATCGGTCATTTGCTTACAAAAAGTCCATCACTTAAT
    GCTGCTAAATCTGAATTAGATAAAGCTATTGGGCGTAATTGCAATGGTGTAATTACAAAA
    GATGAGGCTGAAAAACTCTTTAATCAGGATGTTGATGCTGCTGTTCGCGGAATTCTGAGA
    AATGCTAAATTAAAACCGGTTTATGATTCTCTTGATGCGGTTCGTCGCTGTGCATTGATT
    AATATGGTTTTCCAAATGGGAGAAACCGGTGTGGCAGGATTTACTAACTCTTTACGTATG
    CTTCAACAAAAACGCTGGGATGAAGCAGCAGTTAACTTAGCTAAAAGTATATGGTATAAT
    CAAACACCTAATCGCGCAAAACGAGTCATTACAACGTTTAGAACTGGCACTTGGGACGCG
    TATAAAAATCTATAA



    Версия 2016 года -6var

    https://img-fotki.yandex.ru/get/517809/249950893.1/0_16afd8_c591449d_orig.png

    https://img-fotki.yandex.ru/get/768139/249950893.1/0_16afd9_74627b67_orig.png






    Версия 2018 года - 7var

    Темно-синим цветом показаны пи-спирали, бирюзовым - одиночные АО попи-коду.  Белок состоит преимущественно из пи-спиралей.



    Этот пример демонстрирует, что РСА не от личает пи- от  310- спиралей.

















    Убедительны ли модельные эксперименты?


    Фолдинг есть, но на уровне третичной структуры белка. На уровне вторичной структуры его нет. Программная аллотропия белков опровергает гипотезу фолдинга


    Технология трансляции генетического кода в структуру белка


    Высоко периодичные структуры белков



    Письмо, которое нужно разослать по лабораториям РСА 

    В лаборатории Наномир создана новая технология определения структуры белковых молекул, которая работает примерно в миллиард раз быстрее РСА. Наша задача в кратчайшие сроки проверить новую технологию, т.к. от её внедрения человечество может получить фантастический эффект.

    Проще всего проверить новую технологию на простых структурах типа поливалина:

    https://img-fotki.yandex.ru/get/509292/ … 5_orig.png



    ETC64880: https://www.ncbi.nlm.nih.gov/nuccore/564568708
    OXS06857: https://www.ncbi.nlm.nih.gov/nuccore/1226034760
    KOF67455: https://www.ncbi.nlm.nih.gov/nuccore/918287724
    OUM69688: https://www.ncbi.nlm.nih.gov/nuccore/1198313040
    PIS11988: https://www.ncbi.nlm.nih.gov/nuccore/1277217132
    KOF75295: https://www.ncbi.nlm.nih.gov/nuccore/918302080
    OLP77457: https://www.ncbi.nlm.nih.gov/nuccore/1129165616
    KYM86846: https://www.ncbi.nlm.nih.gov/nuccore/1009361734?&fmt_mask=65536 
    OTF86159: https://www.ncbi.nlm.nih.gov/nuccore/CM007906.1?report=fasta&sat=37&satkey=307832265&itemID=1362
    KKF17324: https://www.ncbi.nlm.nih.gov/nuccore/808866584?&fmt_mask=65536 
    XP_002382247: https://www.ncbi.nlm.nih.gov/nuccore/238502026
    OLP98873: https://www.ncbi.nlm.nih.gov/nuccore/1129194414
    CDW76368: https://www.ncbi.nlm.nih.gov/nuccore/678335661
    AHB99005: https://www.ncbi.nlm.nih.gov/nuccore/564747871?&fmt_mask=65536 
    OAQ27448: https://www.ncbi.nlm.nih.gov/nuccore/1032646064
    OUM69730: https://www.ncbi.nlm.nih.gov/nuccore/1198313040
    OGL53990: https://www.ncbi.nlm.nih.gov/nuccore/1084158629
    EIE92391: https://www.ncbi.nlm.nih.gov/nuccore/76151980
    XP_001590524: https://www.ncbi.nlm.nih.gov/nuccore/156049114
    OTG33229: https://www.ncbi.nlm.nih.gov/nuccore/CM007891.1?from=7600734&to=7601591&sat=37&sat_key=307832447 
    OLQ06943: https://www.ncbi.nlm.nih.gov/nuccore/1129204435
    XP_001895277: https://www.ncbi.nlm.nih.gov/nuccore/170580473
    XP_001584576: https://www.ncbi.nlm.nih.gov/nuccore/156030497
    KOF84884: https://www.ncbi.nlm.nih.gov/nuccore/918315370

    Возможно ли методом РСА определить структуру этих участков белковых молекул? Если да, то нужен прайс.

    С уважением, Руководитель лаборатории Наномир, Александр Кушелев


    Кушелев Александр Юрьевич: Мы с Викторией соколик стали обсуждать фолдинг, и тут выяснилось, что она перепутала углы поворота транспортной РНК и белковой спирали 
    Отсюда и странные углы спиралей...


    Victoriy пишет:

    активное втюхивание того, что может сделать программа Кушелева (2D-схему белка), вместо того, что хотят видеть заказчики 3D-модель белка, не приведёт к желаемому результату.


    Кушелев: Тут есть ряд нюансов. Во-первых, нужно объяснить всем, кто хочет видеть 3D-модели белков, что рентгеноструктурный анализ (РСА) в действительности не может достоверно показать даже вторичную структуру белка. Что касается третичной и четвертичной, то РСА показывает их условно, т.е. взаимное расположение неких крупных ассоциаций, например, спиральных участков. При этом РСА часто не может отличить разные типы спиралей, например, пи-спираль от альфа-спирали, альфа-спираль от 310-спирали. А большинство спиральных участков гибридные, т.е. представлены чередованием композиций альфа- и 310-спиралей. С помощью РСА об этом не удалось узнать за многие десятилетия исследований. Поэтому доверие к интерпретации данных РСА держится на недостатке знаний в этой области, т.е. грубо говоря на невежестве профессионалов по молекулярной биологии 

    Во-вторых, программа Пикотех 3D позволяет показать и проконтролировать достоверность 3D моделей для некоторых участков белковых молекул. Например, для циклов, замкнутых через дисульфидные мостики. Речь идёт о циклах лизоцимов, где методом структурного анализа надежно установлены факты замыкания циклов через дисульфидные мостики:

    https://img-fotki.yandex.ru/get/874801/249950893.1/0_16b0ad_a660053_orig.png

    http://nanoworld88.narod.ru/data/285.htm
    http://nanoworld88.narod.ru/data/586.htm
    Цитата: В общей сложности построены модели 6 замкнутых через дисульфидные мостики участков.
    1. Cys 95 - Cys 113 в человеческом лизоциме.
    2. Cys 96 - Cys 117 в альтернативном человеческом лизоциме.
    3. Cys 78 - Cys 82  в альтернативном человеческом лизоциме.
    4.  Cys 94 - Cys 98  в лизоциме куриного яйца
    5.  Met 1 - Cys 13  в мышином лизоциме
    6.  Met 1 - Cys 24  в лизоциме куриного яйца


    Другой пример - длинные фундаментальные (альфа-, 310-, пи-) и программные спирали:


    https://img-fotki.yandex.ru/get/509292/158289418.4a7/0_186c5c_1ebe5075_XL.png


    Кушелев: Если Вы признаёте существование программных спиралей, то
    1. Во-первых, почему они не изображаются у Вас на уровне 2D-структуры?
    2. О каком фолдинге может идти речь, если 3D модель программных спиралей строится по таблице композиционного кода?


    Victoriy пишет:

    Специфика 3/10, пи- и альфа-спиралей формируется уже в ходе процесса фолдинга на основе простейшего структурного шаблона 3/10 спирали.


    Кушелев: А тут подробнее, пожалуйста.

    Вот вторичная структура двух полилизинов:


    https://img-fotki.yandex.ru/get/892397/158289418.4a9/0_186f36_d8ccd8b5_orig.png



    Вот, что показывает для пи-спирали алгоритм Кушелева и Соколик:


    https://img-fotki.yandex.ru/get/893753/158289418.4aa/0_187195_bcb5486a_orig.gif



    Ваш алгоритм 2D ничего не показывает. Откуда при 3D моделировании у Вас появляется пи-спираль? Каков конкретный алгоритм Вашей 3D программы, который строит пи-спираль по коду:


    >XM_022674627.1 PREDICTED: Astyanax mexicanus protein FAM133-like (LOC111193520), partial mRNA
    GTCCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAAAAAAAAAAAAAAAA


    Victoriy пишет:

    декодированные спиральные структуры белка не обязательно сохраняются в полном объёме в его функциональной конформации после фолдинга: нередко они полностью трансформируются в бета-тяжи и петлевые структуры/повороты.  Пересмотрите примеры в монографии "Пикотехнология белков", там много таких белков.


    Кушелев: Вот мне и интересно, как эти два белка (пи-спиральный и альфа-спиральный) моделируются в Вашей программе. Можно пошагово показать, как по коду n(AAA) Ваша программа получает пи-спираль, а по коду n(AAG) - альфа-спираль. И ещё очень интересно посмотреть Вашу 3D модель программной 35-спирали, когда коды AAA и AAG чередуются. По моей таблице композиционного кода получается такая модель:


    https://img-fotki.yandex.ru/get/52656/158289418.3e5/0_176e45_d9eaf001_orig.png

    Пример программной 35-спирали (компактное 2D-представление)


    https://img-fotki.yandex.ru/get/169883/158289418.3df/0_1760dd_d85de618_orig.png

    Пример программной 35-спирали (развернутое 2D-представление)

    https://img-fotki.yandex.ru/get/198860/158289418.3e0/0_176329_6d9df850_L.gif

    Подробнее: https://subscribe.ru/archive/science.ne … 3210.html/
    3D-модель белковой молекулы с программной 35-спиралью.


    Victoriy пишет:

    программа "Молекулярный конструктор" Виктории Соколик способна выдавать как 2D-схему, так и 3D-модель структурного шаблона белка по детерминирующей его нуклеотидной последовательности.


    Кушелев: Это очень здjрово. Но хотелось бы уточнить, как конкретно, т.е. по шагам, получается, например, 3D модель этого белка:


    https://img-fotki.yandex.ru/get/893753/158289418.4aa/0_187195_bcb5486a_orig.gif


    2D структуру алгоритм, реализованный в программе Prosolver не показывает, но и "не очень-то хотелось". Интересно посмотреть по шагам, как программа Молекулярный конструктор строит 3D-модель этого белка, т.е. пи-спираль. Ну и сравнить с постройкой альфа-спирали из тех же остатков лизина.

    Сможете показать по шагам работу алгоритма?


      Victoriy пишет:

      Единственно что необходимо для полноценного удовлетворения заказчика, это виртуально в соответствующих программах (типа молекулярная динамика - МД) оптимизировать полученную структуру шаблона белка с учетом ближнего физ-хим. окружения его молекулы, т.е. смоделировать его фолдинг как бы в природных условиях, но виртуально.


      Кушелев: Гипотеза фолдинга опровергается программной аллотропией (композиционным кодированием) структуры белка:


      https://img-fotki.yandex.ru/get/879536/158289418.4a9/0_186fc0_a6332fad_orig.png


      Что касается программ оптимизации, то стандартные программы не учитывают кольцевую форму электрона, поэтому непригодны для оптимизации пикотехнологических моделей.


        Victoriy пишет:

        ... любая заказываемая модель белка необходима не просто так для красоты и любопытства, а для её дальнейшего изучения на предмет эффективности связывания (образования комплекса) с целевыми лигандами - виртуального докинга. Последний шаг и есть практическое внедрение в фармакологии, биотехнологии и др. областях.
        Поэтому на этапах молекулярная динамика/докинг лаборатории Наномир понадобятся услуги опытного молекулярного биолога либо специального он-лайн сайта (такие принимали участие в CASP), а не кучи программистов, о которых говорит А.Ю. Либо же предлагать лабораториям структурный шаблон белка и оговаривать, что они должны над ним ещё сами поработать вышеописанным способом (обычно специалистов по МД и докингу в таких лабораториях достаточно).


        Кушелев: Конечно, можно пытаться оптимизировать пикотехнологическую модель нанотехнологическими алгоритмами, но это неэффективно. Это примерно то же самое, что собирать айфон методом лепки из глины.


        Для тех, кто не видит картинки, я буду подписывать: "Айфон, слепленный из пластилина".

        Другое дело - создать программы оптимизации пикотехнологического уровня. Это безусловно сложнее, но и результат будет соответствующий:


        https://img-fotki.yandex.ru/get/874801/249950893.1/0_16b0ad_a660053_orig.png

        Цикл лизоцима, замкнутый через дисульфидный мостик.


        Нужно обратить внимание на то, что 3D модели некоторых участков белков получаются с пикотехнологической точностью даже без оптимизации, т.е. на уровне геометрического алгоритма. Согласитесь, что точность на уровне пикометров впечатляет по сравнению с тем, что РСА не может отличить пи-спираль от альфа-спирали.


          aest пишет:

          А к чему вся эта дискуссия по альфа спиралям сейчас ?


          Кушелев: А при том, что альфа-спираль является жесткой структурой. Ее можно повернуть на суставе Pro относительно другой спирали:

          А Виктория предлагает менять вторичную структуру. А это равносильно "размягчению костей"


          https://img-fotki.yandex.ru/get/39073/158289418.4b0/0_188d68_2a2cc483_orig.jpg


            Victoriy пишет:

            Обратите Ваше пристальное внимание на то, что углы композиции между аминокислотными остатками задаются внутри рибосомы, а вот водородные связи, дополнительно фиксирующие их взаимное расположение уже на выходе из неё.


            Кушелев: С чего бы это? Если аминокислота соединена с предыдущей, водородная связь образуется за миллисекунду:

            https://img-fotki.yandex.ru/get/5306/158289418.4b0/0_188d69_68f6c850_XL.jpg

            Подробнее о протонной релаксации водородных связей: http://crm-en.ics.org.ru/uploads/kim3/crm09307.pdf

            Victoriy пишет: В рибосоме водородные связи не образуются, только на выходе из неё за те же миллисекунды.


            Кушелев: С чего Вы это взяли? В канале рибосомы умещаются даже все радикалы альфа-спирали. Это значит, что там та же среда, что и за пределами рибосомы. Те же молекулы воды, протоны, образующие водородные связи. Как только присоединена очередная аминокислота (0.2 ... 0.6 сек), так уже через миллисекунду образуется водородная связь, т.е. до установки следующей аминокислоты. Другого варианта нет.


            Victoriy пишет: Вы уже заложили свою таблицу композиционного кода и углы для альфа-спирали и Вам проще отстаивать эту ошибку


            Кушелев: Зачем отстаивать? Эксперимент показывает, что для замыкания дисульфидных мостиков фолдинг не нужен 

            Цикл, собранный по геометрическому алгоритму замыкается и без него:




            Кушелев: Изменение нескольких углов может привести к тому, что цикл из 22 аминокислот не замкнется вообще, т.е. не с вероятностью 1/30 000 000 000, а с вероятностью строго равной нулю (=0).

            Поэтому я и пишу, что замыкание 6 циклов из разных лизоцимов не может быть случайностью. Эти замыкания показывают, что таблица композиционного генетического кода и композиционные углы правильные. Не все, конечно, а только те, которые принимают участие в формировании этих циклов.


              Victoriy пишет:

              статистический анализ приведенный в монографии "Пикотехнология белков", на основе которого сделана моя таблица композиционного кода, не показал специфику кодирования альфа- и 3/10 спиралей разными кодонами. Вашей статистики на этот счет нет, поэтому такое утверждение голословно, и ненаучно его отстаивать.


              Кушелев: Если анализ не показал, то это не означает, что повторный анализ не покажет 

              Мы с Вами знаем, что специалисты по рентгеноструктурному анализу редко отличают 310-спираль от альфа-спирали. Более того, за многие десятилетия существования РСА протяженные участки пи-спиралей вообще оказались незамеченными...

              А они есть!

              https://img-fotki.yandex.ru/get/872977/158289418.4b0/0_188a4f_2dc82619_orig.png



              Так что в следующей книге "Пикотехнология белков-2" у Вас есть возможность продемонстрировать и 6 фрагментов лизоцимов, замкнутых через дисульфидные мостики без фолдинга, и сверхдлинные фундаментальные и программные спирали белковых молекул, структура которых определена по таблице композиционного кода, где Ваши данные для альфа- и пи-спиралей полностью совпадают с моими. Вы ещё хотели показать экспериментальные данные, с которыми совпадают Ваши альфа- и пи-спирали длиной более 63 витков:


              https://img-fotki.yandex.ru/get/892397/158289418.4a9/0_186f36_d8ccd8b5_XL.png
              Оригинал: https://img-fotki.yandex.ru/get/892397/ … 5_orig.png


              А если этих экспериментальных данных еще нет, то что мешает их получить? В институте белка мне сообщили, что определить структуру с помощью РСА могут в Курчатовском институте. Давайте вместе предложим им определить две структуры полилизина, закодированные триплетами n(AAG) и n(AAA).


              Кушелев: На иллюстрации показано, что вторичная структура, построенная по алгоритму Виктории Соколик на 100% совпадает со вторичной структурой, полученной по композиционной таблице Кушелева. Это только в программе от Prosolver коду AAA ничего не соответствует, а по алгоритму Виктории Соколик код AAA соответствует левой спирали, т.е. пи-спирали. Вам осталось подправить углы пи-спирали, чтобы не пришлось получать "те же результаты другим способом" уже в 3D версии программы 

              Если я не ошибаюсь, Вы предлагаете строить модель пи-спирали в два этапа. На первом построить неправильную левую спираль (3 АО на виток), т.е. с неправильными водородными связями, соединяющими n-ый АО с (n+3)-им, а на втором этапе переделать неправильную левую спираль в правильную пи-спираль, т.е. разорвать все водородные связи n ... (n+3), изменить все углы между аминокислотными остатками со 120 градусов до 87, после чего сделать заново все водородные связи, но уже не с третьим АО, а с пятым, т.е. n ... (n+5). Другими словами, неправильно построить, потом всё сломать и построить правильно. А почему нельзя сразу сделать правильно по Вашей же таблице композиционного кода, которая в этом месте на 100% совпадает с моей? Просто сразу взять правильные углы пи-спирали. 


                              http://img-fotki.yandex.ru/get/6210/126580004.53/0_bcc31_366c6e2c_S.gif           http://img-fotki.yandex.ru/get/6304/126580004.53/0_bcc32_4f52ef7b_S.gif      http://img-fotki.yandex.ru/get/6302/126580004.52/0_bcc2f_a96d98c5_S.gif       http://img-fotki.yandex.ru/get/6307/126580004.52/0_bcc30_b4791ec4_S.gif           
                               Альфа-спираль                Бета-спираль                  Пи-спираль                    310-спираль

              Подробнее можно посмотреть в 287-ом выпуске рассылки: http://nanoworld88.narod.ru/data/287.htm


              Когда Виктория Соколик,  писала книгу "Пикотехнология белков", научных открытий, о которых сегодня идет речь, ещё не было. Поэтому эти иллюстрации не могли попасть в книгу из будущего:


              https://img-fotki.yandex.ru/get/509292/158289418.4a7/0_186c5c_1ebe5075_XL.png

              https://img-fotki.yandex.ru/get/879536/158289418.4a9/0_186fc0_a6332fad_orig.png


              Но буквально вчера выяснилось, что в программе от Prosolver вторичная структура показана не так, как должна быть показана согласно таблице композиционного кода от Виктории Соколик.

              Там, где программа показывает отсутствие вторичной структуры, в действительности по таблице Виктории Соколик вторичная структура есть. Это структура левой спирали, т.е. пи-спирали:


              https://img-fotki.yandex.ru/get/872977/158289418.4b0/0_188a4f_2dc82619_orig.png


              Так что разногласий во вторичной структуре нет. Разногласие в величине угла, т.е. на уровне пространственной модели, т.е. 3D версии программы.

              Виктория считает, что рисобома собирает левую спираль с углами по 120 градусов (три АО на виток), после чего некий "фолдинг" ломает эту структуру, т.е. разрывает водородные связи n ... (n+3), меняет все углы со 120 на 87 градусов и создаёт все водородные связи заново, т.е. уже n ... (n+5). А я считаю, что рибосома строит пи-спираль с первого раза. Без мистического фолдинга.


                aest пишет:

                лизоцим не является жесткой фигурой, подобной треугольнику, там вполне возможно согласованно поизменять углы без разрыва дисульфидного мостика, подобно тому, как это можно сделать в параллелограмме


                Кушелев: Только он замкнулся через дисульфидный мостик без изменения углов. А это значит, что фолдинга нет на уровне вторичной структуры. Кстати, Вы можете "поизменять углы" и выложить на форум результат своего колдовства. Интересно посмотреть, что за углы Вы будете менять, и удастся ли Вам поменять их согласованно?  

                Ваши "просто слова" против модельного эксперимента ровным счётом ничего не значат 


                Сначала измените согласованно углы, но не в параллелограмме, а в модели фрагмента лизоцима, а мы посмотрим, замкнётся ли он после этого или нет.


                  Вы строите свою таблицу кодирования разновидностей спиралей опираясь на свои фантазии и отмахиваясь от результатов статистики.


                  Кушелев: Вообще-то я сразу показал, как я строил свою таблицу композиционного генетического кода: http://www.nanoworld.org.ru/data/01/dat … 920204.htm

                  Я воспользовался данными РСА для наиболее изученных белков. При этом на пластмассовых моделях я получил параметры альфа-спирали, 310-спирали, пи-спирали и бета-спирали. Модельные эксперименты показали, что составленная таблица композиционного кода работает без ошибок. Позднее, когда сборка моделей белка была автоматизирована, обнаружился цикл лизоцима, замкнувшийся через дисульфидный мостик без фолдинга, т.е. строго по таблице композиционного кода.

                  Ещё позднее я нашел ещё 5 фрагментов разных лизоцимов, замнувшихся без фолдинга.

                  Более того, в процессе этого исследования я обнаружил замыкание дисульфидных мостиков не только между цистеинами, но и между цистеином и метионином, что явилось научным открытием, согласитесь. Вам известно, что дисульфидные мостики могут образовываться между цистеином и метионином?



                  Здесь программа от Prosolver показывает отсутствие вторичной структуры по композиционному коду пи-спирали, но мы уже выяснили, что таблицы композиционного кода по части пи-спирали совпадают, поэтому в действительности эти циклы лизоцима обязаны замкнуться и по алгоритму Виктории Соколик  


                  Кстати, эти модели совпадают и с экспериментальными данными, если не считать дисульфидных мостиков между цистеином и метионином. Но тут уж дело времени. Должны появлиться экспериментальные данные и по дисульфидным мостикам между метионином и цистеином. Рано или поздно экспериментаторы должны обнаружить эти мостики...






                    Меняйте согласованно углы. Но не забывайте, что эти углы не лежат в одной плоскости

                     

                    aest пишет: Возьмите металлическую цепь о тысячи звеньях, замкните. Бросьте комком на землю. Сколько там углов между звеньями согласованно изменились не лежа при этом в одной плоскости? Цепь не разомкнулась. Мистика...


                    Кушелев: Жаль, что Вы не отличаете механизм белковой молекулы от механизма цепи. В молекуле белка вращение происходит вокруг некоторых осей:



                    http://img-fotki.yandex.ru/get/9217/158289418.af/0_ae268_6a1e1ddb_S.gif 


                    В учебнике молекулярной биологии есть такой термин: "вращение затоможено". Это определяется как раз структурой электронной оболочки молекулы. Так же, как рука может гнуться в локте не по любому направлению. Сустав - это не шарнир. 



                      абсолютно не соответствующие реальному механизму трансляции белка.

                      А соответствует очередь протонов на образование водородных связей в альфа-спирали на выходе из канала рибосомы? 


                      Кушелев: Вы согласны, что в канале рибосомы присутствуют протоны? Если согласны, то что им мешает через миллисекунду после установки очередного аминокислотного остатка образовать водородную связь? Т.е. ещё до того, как тРНК отпустит аминокислотный остаток, который она держит 4-мя вандерваальсовыми связями:



                      Подробнее: http://nanoworld88.narod.ru/data/216.htm





                      Подробнее: http://nanoworld88.narod.ru/data/247.htm



                        http://img-fotki.yandex.ru/get/2708/158289418.195/0_fc3b9_fb8aea95_orig.jpg


                        Кушелев: Судя по этой схеме, Виктория отмеряет углы поворота tRNA вокруг оси белковых спиралей.

                        Увжаемая Виктория! А Вас не смутил угол 0 градусов? Или Вы его "смело заменили" на 180 градусов? 

                        Кстати, эту ошибку легко исправить.

                        Достаточно организовать "фолдинг" таблицы композиционных углов от Виктории Соколик, чтобы получилась таблица композиционных углов от Александра Кушелева.

                        Сами структуры белков фолдировать не нужно. Достаточно фолдировать  таблицу углов 

                        А я никак не мог понять, откуда Вы такие углы берете? Это можно назвать "антифолдинг" таблицы композиционных углов.  Осталось добавить "фолдинг" таблицы композиционных углов, "и всех делов" .



                        Получается, что Вы не показывали Prosolver иллюстрации, где показано, вокруг каких осей вращаются модели аминокислотных остатков?



                        Есть же описание алгоритма от Евгения Неделько, которое находится в открытом доступе с 1998 года.

                        В программе Неделько выводились только координаты центров атомов, а углы были взяты у Рамачандрана. Это уже в более поздней версии Дениса Савина программа скрипт стала выводить не только координаты центров атомов, но и кольцегранные оболочки. Помню Вы там ещё ошибку нашли. Правда, программа правильно заработала после исправления второй ошибки. Оказалось, что Денис Савин перепутал в одном месте координату в уравнениях. Потом мы с Валентином поменяли зеркальные отражения аминокислотных остатков на правильные и промасштабировали модели по экспериментальным данным.

                        Кстати, в программе Дениса Савина вращение тоже реализовано не вокруг одной оси, как было бы естественно, а последовательно вокруг трёх декартовых осей. Это уже связано с вычислительной средой. При этом сначала оказалось, что все спирали строятся правильно, а изломы спиралей неправильно. Выяснилось, что правильные углы между спиралями разных типов получаются при правильном задании начала отсчета углов. Другими словами, нужно поставить аминокислоту в правильную позицию, правильно сориентировать по всем трем осям, после чего получаются корректные модели белков. Но это только геометрический уровень.


                        aest пишет:

                        Вы приводите в качестве примеров жесткие фигуры, у которых грани как раз треугольники. Но масса таких фигур ничтожна по сравнению с массой нежестких фигур. Так что основной, имеющий важность для науки вывод не опровергнут: фолдинг есть. А вы можете и дальше его не замечать, пусть он тут для других зияет


                        Кушелев: Вы очень настойчиво не хотите изучать азы философии. Кстати, Ваше заявление по поводу "массы таких фигур", применительно к белкам, тоже ошибочно. Подавляющее большинство белков содержат альфа-спиральные участки. На этих иллюстрациях они показаны красным цветом. Их можетбыть много, может быть мало.

                        https://img-fotki.yandex.ru/get/962386/158289418.4ae/0_187d05_fb266b6c_XL.pnghttps://img-fotki.yandex.ru/get/893904/158289418.4af/0_188265_9e1f5dfb_orig.png


                        Альфа-спиральные участки присутствуют в подавляющем большинстве белков. Их отсутствие является редким исключением. Так что Вам срочно нужна новая ошибка "для оправдания" 

                        https://img-fotki.yandex.ru/get/4701/158289418.4b0/0_188d66_d24e8b17_orig.jpg


                        Попобуйте, поколдуйте, например, над жёсткостью альфа-спирали.


                        aest пишет:

                        фолдинг происходит благодаря наличию у белка "суставов", т.е. мест, где он легко может гнуться, о чем и говорит Виктория. Так что, повторюсь, основной, имеющий важность для науки вывод не опровергнут: фолдинг есть, а пикотехнология Кушелева ошибочна


                        Кушелев: Вы, вероятно, не поняли моего объяснения. На суставах может гнуться третичная структура белка, т.е. состоящая, например, из жёстких альфа-спиральных участков. Действительно, на уровне третичной структуры есть и фолдинг, т.е. однократная "укладка жестких участков вторичной структуры на суставах Pro", и динамический "фолдинг", т.е. по существу функционирование пико-механизмов. Я даже показал динамические модели белков, демонстрирующие этот динамический "фолдинг":

                        http://img-fotki.yandex.ru/get/2712/126580004.3f/0_b1b0c_a4931b42_S.gif http://img-fotki.yandex.ru/get/9116/158289418.af/0_ae267_2d0606e3_orig.gif http://img-fotki.yandex.ru/get/5506/126580004.42/0_b37ab_6493b0b7_S.giff

                        Однако Виктория пишет не об этом "фолдинге третичной структуры", а именно о мистическом фолдинге вторичной структуры, когда этот мистический "фолдинг" должен сначала разрушить построенные рибосомой "шаблоны", например, левую спираль с углами между аминокислотными остатками в 120 градусов, разорвать все водородные связи n ... (n+3), изменить все углы со 120 на 87 градусов и замкнуть заново все водородные связи уже по схеме n ... (n+5). Вот о чём дискуссия, а не о том, что угол между альфа-спиральными участками может меняться на Pro.

                         

                          aest пишет:

                          Напоминаю слова Виктории:
                          "Кстати фолдинг это не кардинальное изменение закодированного структурного шаблона, а лишь его "косметическая" оптимизация."

                          Кушелев: А за этими словами кроется разрушение всех водородных связей, изменение всех углов и создание всех водородных связей заново. Вот такая "травматическая косметика"

                           

                          http://img-fotki.yandex.ru/get/6210/126580004.53/0_bcc31_366c6e2c_S.gif http://img-fotki.yandex.ru/get/6302/126580004.52/0_bcc2f_a96d98c5_S.gif
                          . . . . . Было . . . . . . . . . . Стало


                          aest пишет:

                          Если я не ошибаюсь, альфа спираль у Виктории получается в результате фолдинга.

                          Кушелев: Совершенно верно! Рибосома по композиционному коду строит сначала 310-спираль (по Виктории):

                          http://img-fotki.yandex.ru/get/6307/126580004.52/0_bcc30_b4791ec4_S.gif http://img-fotki.yandex.ru/get/6210/126580004.53/0_bcc31_366c6e2c_S.gif
                          310-спираль           альфа-спираль


                          после этого мистический фолдинг (будем называть вещи своими именами) разрушает все водородные связи n ... (n+3), меняет все углы между аминокислотными остатками с 120 градусов (3 АО на виток) до 100 градусов (3.6 АО на виток), после чего создает все водородные связи заново. "Травматическая косметика" в двух словах


                          Victoriy пишет:

                          А как насчет Вашего обобщения частного случая лизоцима до всей когорты белков? Это ли не грубейшая философская ошибка, ведь дисульфидные мостики имеет менее 1 % белков.


                          Кушелев: Давайте разберёмся. Если 1% белков строится по композиционному генетическому коду, то какой вывод можно сделать о принципах сборки белков? Могут ли белки, в которых есть дисульфидные мостики строиться по иным принципам, чем остальные белки? Может ли альфа-спираль собираться по композиционному коду, а пи-спираль без композиционного кода?

                          Если уж композиционный код обнаружен, значит он работает для всех белков рибосомальной сборки. Не может же рибосома "тут работать, а там не работать". Это же абсурд!

                          Конечно есть нюансы. Рибосомы митохондрий работают по слегка другой таблице композиционного кода:

                          https://img-fotki.yandex.ru/get/106972/158289418.3c5/0_1713fb_cf7f7637_orig.png

                          Более того, в некоторых организмах используется своя таблица генетического кода, но это нюансы. Если рибосома работает, то она работает одинаково при сборке любых рибосомальных белков.


                            Victoriy пишет:

                            что Вы носитесь с этими дисульфидными мостиками лизоцима. Никто же не спорит о закодированности структуры белка в разной степени сохраняющейся в конформации белка после фолдинга последнего.


                            Кушелев: Если пространственная структура сохранилась в циклах лизоцимов на все 100%, то  фолдингтне нужен. 


                              Victoriy пишет:

                              для лизоцима можно предположить замыкание находившихся по соседству в пространстве (а не в линейной последовательности аминокислот) SH-групп цистеинов в дисульфидные мостики ещё на этапе синтеза его структурного шаблона, что способствовало сохранению пространственного взаиморасположения КЛЮЧЕВЫХ узлов в этом ферменте (в частности активного центра).


                              Кушелев: Так по соседству атомы серы могут оказаться только в одном случае. Если все остатки установлены строго по композиционному коду. Случайно это невозможно. Для одного цикла из 22 АО вероятность случайного "расположения по соседству" равна 1/30 000 000 000, а для всех 6 циклов разных лизоцимов эту вероятность нужно ещё в 6-ю степень возвести. Получится (1/30 000 000 000)^6 = 1,37e-63 Просто нереальная вероятность.


                                Victoriy пишет:

                                Гомологичные лизоцимы унаследовали найденный природой ход своего уникального сворачивания для формирования активного центра,

                                Кушелев: Если структура в окончательном варианте построена по коду, её уже невозможно свернуть. Она уже "свёрнута". Вы пытаетесь "фолдингом" положить в карман то, что там уже лежит.

                                В процессе эволюции композиционный код подстраивался под физико-химические взаимодействия, поэтому после денатурации белки иногда могут полностью ренатурировать. Но рибосома по композиционному коду собирает их не денатурированными, согласитесь. Известно же, что рибосома собирает белки быстро, а ренатурируют они медленно. Так что фолдинг тут неуместен.


                                Victoriy пишет:

                                остальные несущественные детали

                                Кушелев: Кстати, о "несущественных деталях". В процессе исследования циклов разных лизоцимов, которые замыкаются через дисульфидные мостики, мне удалось обнаружить, что эти самые дисульфидные мостики возникают не только между цистеинами, но и между цистеином и метионином! Это научное открытие тоже прошло незамеченным, а зря...


                                Victoriy пишет:

                                моя программа Молекулярный конструктор по коду AAG построит шаблон правой спирали полилизина, а по коду ААА - соответственно левой спирали. А далее виртуальный фолдинг с поиощью МД придаст им вид альфа- и пи-спиралей, если конечно их устойчивость выиграет в противостоянии с влиянием микроокружения. Вы же в курсе, что закодированные спирали сохраняются в конформации белка в лучшем случае на 80-90%, а в худшем - на 10-20 %.


                                Кушелев: Итак, в процессе дисскуссии выяснилось, что после исправления программы от Prosolver вторичные структуры полилизинов, построенных по кодам n(AAA) и n(AAG) по Соколик и Кушелеву полностью совпали:


                                https://img-fotki.yandex.ru/get/872977/158289418.4b0/0_188a4f_2dc82619_orig.png


                                Однако, Виктория Соколик утверждает, что рибосома соединяет водородными связями остатки левой спирали через 3 АО, а потом некий "фолдинг" разрушает все эти водородные связи и создаёт заново, но уже через 5 АО. Согласитесь, что это абсурд.


                                  https://img-fotki.yandex.ru/get/872977/158289418.4b0/0_188a4f_2dc82619_orig.png

                                  Алгоритм определения вторичной структуры полилизина у Вас оказался правильный, т.е. точно такой же, как у меня. Просто в программе от Prosolver он не был реализован.

                                  Осталось исправить таблицу углов, т.е. чтобы по коду пи-спирали строилась именно пи-спираль, а не полуфабрикат, который потом нужно переделывать в пи-спираль


                                  Victoriy пишет:

                                  это не совпадение с Вашими моделями, а соответствие экспериментальным данным.

                                  Кушелев: Я бы рад ошибиться и признать свою ошибку, особенно, если Вы сможете показать экспериментальные данные по белку: XM_022674627, который является прямой пи-спиралью длиной 263 аминокислотных остатка, т.е. 263/4.1=64 витка прямой пи-спирали.

                                  И это при том, что официально считается: http://info-farm.ru/alphabet_index/p/pi-spiral.html
                                  Цитата:  Длинная ливозакручена π-спираль вряд наблюдается в белках
                                  Конец цитаты.

                                  https://ru.wikipedia.org/wiki/%D0%92%D1 … 1%80%D0%B0
                                  Цитата: π-спираль, или спираль 516, — спираль с широкими витками, в результате в центре спирали остаётся пустое пространство. В белках встречается редко, обычно не более одного витка.


                                    aest пишет:

                                    Виктория утверждает, что замыкание происходит во время синтеза структурного шаблона, а потом происходит фолдинг.


                                    Кушелев: Вы точно ничего не напутали? Если дисульфидный мостик замкнулся, то пространственная структура белка зафиксирована. Это всё равно, что закрыть дверь на ключ.

                                    Гипотеза фолдинга заключается в том, что из рибосомы выходит типа линейная цепочка аминокислотных остатков, которая сама, т.е. уже без рибосомы, сворачивается в объёмную конструкцию.

                                    А я на примере циклов лизоцимов показал, что углы между аминокислотными остатками запрограммированы в таблице композиционного генетического кода, т.е. рибосома по композиционному коду сразу собирает вторичную структуру белка. Например, если код n(AAG), то из рибосомы выходит прямая альфа-спираль с водородными связями между n-ой и n+4-ой пептидными группами. Если код n(AAA), то выходит прямая пи-спираль с водородными связями между n-ой и n+5-ой пептидными группами. Сворачивать уже ничего не требуется. Либо нужно сначала разломать закодированную вторичную структуру,  а потом снова сделать, что абсурдно, согласитесь. Открытие композиционного кода опровергло гипотезу фолдинга. Другое дело - укладывание вторичной структуры белка в третичную. Если между спиральными участками попадаются суставы Pro, то спиральные участки могут двигаться, как кости скелета на суставах. И тут уже вступают в действия силы притяжения и отталкивания между участками спиралей. Этот процесс вполне можно назвать фолдингом, но ... фолдингом уровня третичной структуры, которая складывается из жестких спиральных (и не очень) участков вторичной структуры. Циклы лизоцимов - это законченные третичные структуры, которые фолдингу не подлежат, т.к. дисульфидный мостик уже замкнулся и зафиксировал пространственную форму. И случилось это в процессе рибосомальной сборки, а не в процессе мистического фолдинга уровня вторичной структуры. Ведь дисульфидный мостик замкнулся уже на уровне геометрического алгоритма, т.е. композиционных кодов и композиционных углов. Это значит, что никаких взаимных движений на суставах Pro не было. Как построили, так и стоит.

                                    Поймите, что нельзя построить (фолдингом или чем угодно) то, что уже построено. Либо надо ломать и строить заново, что абсурдно.


                                    Victoriy пишет:

                                    и левая спираль или поворот (NNА)


                                    Кушелев: А это уже ближе к делу. Значит Ваша программа по коду AAA действительно построит не правую, а левую спираль. Но реальная пи-спираль имеет 4.1 аминокислотных остатка на виток: http://info-farm.ru/alphabet_index/p/pi-spiral.html .

                                    Аминогруппа одной аминокислоты формирует водородную связь с C = O группой аминокислоты на пять остатков ранее

                                    А это значит, что Ваш "фолдинг" должен разорвать все водородные связи с третьими аминокислотными остатками и создать новые водородные связи с пятыми аминокислотными остатками, что сами понимаете, нереально.

                                    По коду AAA рибосома сразу ставит аминокислоту так, чтобы водородная связь замкнулась на пятый аминокислотный остаток. И не надо ничего переделывать 

                                    Но самое интересное, что пи-спираль в Вашей программе так же однозначно закодирована, как и в моей программе Пикотех, т.е. в Вашей таблице AAA - тот же композиционный код пи-спирали, а код AAG - тот же композиционный код альфа-спирали.

                                    Вы просто ввели в заблуждение отсутствием вторичной структуры в программе от Prosolver:


                                    https://img-fotki.yandex.ru/get/872977/158289418.4b0/0_188a4e_da59f44a_XL.png


                                    Пи-спираль по коду AAA (Кушелев) и отсутствие вторичной стуктуры по коду AAA (Соколик)

                                    Я так понял, что эту ошибку Вы частично исправили в программе "Молекулярный конструктор", т.е. теперь по коду AAA программа показывает не отсутствие вторичной структуры, а левую спираль, но ещё не 4.1 аминокислотных остатка на виток, а 3. Но это тоже дело поправимое. Ведь в следующей версии можно изменить 3 на 4.1. И не нужно никаких чудо-"фолдингов" для превращения всех неправильных углов пи-спирали в правильные 


                                    Victoriy пишет:

                                    На основе структурного шаблона правой спирали в ходе фолдинга могут быть смоделированы все три основных разновидностей правых спиралей: 3/10-, альфа- и пи-.

                                    https://img-fotki.yandex.ru/get/879536/158289418.4b0/0_188a4d_9aa25f67_XL.png

                                    Кушелев: Так-так-так... Пи-спираль вообще-то левая, 4.4 остатка на виток. Но я уже писал, что бог с ними, с этими переделками 310-спирали в разные спирали белков. Вы скажите, откуда "фолдинг" узнает, во что переделывать "310-шаблон". Ведь информация о том, что полилизин будет пи-спиралью, содержится в кодах: n(AAA), а информация о том, что полилизин будет альфа-спиралью, содержится в кодах n(AAG). В шаблоне информации типа AAA/AAG уже не содержится. Верно? Так откуда "фолдинг" узнает, во что переделывать шаблон? Где информацию брать? 

                                    Рассмотрите пи-спираль полилизина, построенная по триплетам AAA и альфа-спираль полилизина, построенная по триплетам AAG.


                                    Victoriy пишет:

                                    фолдинг этих самых структурных шаблонов в энергетически устойчивую функциональную конформацию


                                    Кушелев: Уважаемая Виктория! Как Вы прокомментируете открытие программных спиралей белковых молекул?

                                    https://img-fotki.yandex.ru/get/509292/158289418.4a7/0_186c5c_1ebe5075_XL.png

                                    Здесь Вы видите 19 вторичных структур поливалина. На схеме вторичной структуры представлены фундаментальные спирали:
                                    альфа-, 310-, пи-, бета-
                                    и программные:
                                    14-, 35-, 352-, 144-, 25-, 22225-, 411412-, 255-, 2444-, 1144-, 11444444-, 23-, 335(коллагеновая)-

                                    Помните, как мы с Вами дискутировали по поводу лизиновых "хвостов", т.е. участков пи-спиралей длиной более 10 аминокислотных остатков? Вы ещё писали, что это всё гипотетические структуры...

                                    А как Вы прокомментируете тему: "Рекорды сверхдлинных спиралей белковых молекул"?

                                    Там встречаются фундаментальные спирали (альфа-, 310-, пи-, бета-) длиной более 3000 аминокислотных остатков. И программные спирали, в т.ч. фрактальные более 100 периодов, например, по 35 аминокислотных остатков в периоде, т.е. более 3500 аминокислотных остатков в спирали.

                                    Если бы была верна гипотеза фолдинга, то зачем было бы кодировать все эти спиральные структуры?

                                    Антигомология = программная аллотропия опровергает гипотезу фолдинга. Согласны?



                                    Нюансы функционирования пикомашины гексамера инсулина

                                    *

                                    *


                                    В центре гексамера инсулина находится ион цинка (на анимации не показан). К нему присоединены 6 групп кислорода, которые входят в состав тирозина. Пикотехнологическая модель показывает, что бензольное кольцо, входящее в состав тирозина, может деформироваться, т.е. менять форму правильного шестиугольника на форму вытянутого шестиугольника. Таким образом, "рот морской звезды" может закрываться силой упругости, как дверь на пружине.


                                    Напомню, что гексамеры инсулина собирают глюкозу, накапливая её в полости, которая напоминает желудок морской звезды...


                                    6 лопастей, со специфическим оперением протонами, позволяет преобразовывать хаотическое движение окружающих молекул физраствора во вращательное и поступательное движение гексамера инсулина. Модель своеборазной броуновской частицы, которая может преобразовывать хаотичекое движение в направленное, можно посмотреть в рассылке: "Новости лаборатории Наномир": http://nanoworld88.narod.ru/data/116.htm


                                    https://img-fotki.yandex.ru/get/509739/249950893.2/0_16b306_82e02946_orig.jpg


                                    http://nanoworld.org.ru/post/9544/#p9544
                                    Кушелев Александр Юрьевич: В 1992-ом я показывал пикотехнологическую модель витамина B12. Подобные модели можно сделать лишь в процессе трудоёмкого научного исследования. А программа Пикотех позволяет определять структуры белка автоматически, обрабатывая очередной файл из генбанка. С помощью этой программы можно делать научные открытия следующего уровня, т.е. не третичной, а четвертичной структуры белка. Ряд таких открытий мне уже удалось сделать. Это - четвертичная структура шаперонов, гистонов, коллагена, тубулина и теперь инсулина. В случае инсулина удалось понять работу механизма, т.е. это следующий уровень после четвертичной структуры. Назовём его пятым уровнем. Это - мировой рекорд.



                                    http://nanoworld.org.ru/post/9593/#p9593

                                    https://img-fotki.yandex.ru/get/373630/249950893.2/0_16b308_35218332_GIForig.gifhttp://img-fotki.yandex.ru/get/9116/158289418.af/0_ae267_2d0606e3_orig.gif



                                    Пикотехнологическая модель атома цинка с перестроенной предвнешней оболочкой. По моему предположению именно такой атом цинка находится в центре гексамера инсулина.



                                    В центре гексамера инсулина находится ион цинка, к которому присоединены аммортизаторы (бензольные кольца), входящие в состав радикалов тирозинов.


                                    https://img-fotki.yandex.ru/get/894110/249950893.2/0_16b2ff_3a28185e_orig.gif

                                    https://img-fotki.yandex.ru/get/894110/249950893.2/0_16b300_791518a3_orig.gif


                                    Бензольные кольца находятся в среднем положении. Их можно как сжать, так и растянуть. В первом случае "рот морской звезды" закроется, во втором случае - откроется максимально.



                                    Компьютер не учитывает физико-химические взаимодействия. Это означает, что в случае гексамера инсулина третичная структура стабильна. Но удивляет точность, с которой радикалы тирозина попадают в центр гексамера. При этом концы спиралей вверху и внизу стыкуются под правильными углами. Т.е. практически остутствует накопление ошибки по углу поворота спирали.



                                    Гексамер инсулина с атомом цинка, образующим комплексное соединение с шестью группами OH, принадлежащими радикалам тирозинов 6 субъединиц инсулина.



                                    https://img-fotki.yandex.ru/get/874316/249950893.2/0_16b304_48443770_GIForig.gif 


                                    https://img-fotki.yandex.ru/get/894110/249950893.2/0_16b301_262e6422_GIForig.gif


                                    https://img-fotki.yandex.ru/get/894110/249950893.2/0_16b303_3ee19cd3_GIForig.gif


                                    Динамика гексамера инсулина в разрезе (пикотехнологическая модель)
                                    В центре гексамера находится атом цинка. В процессе деформации бензольные кольца радикалов гистидинов вытягиваются при раздвигании субъединиц инсулина и сдавливаются при сдвигании. Процесс может быть колебательным, если добротность этой резонансной системы достаточна.




                                      https://img-fotki.yandex.ru/get/509739/249950893.2/0_16b305_bfcde745_GIForig.gif


                                      Пикотехнологическая модель коннексона в открытом и закрытом состоянии

                                      *

                                      *

                                      Модель 2012 года, версия 4 var

                                      http://molbiol.ru/forums/index.php?show … &st=50


                                      https://img-fotki.yandex.ru/get/892397/249950893.2/0_16b380_65c899c0_GIForig.gif

                                      https://img-fotki.yandex.ru/get/872977/249950893.2/0_16b384_87b60497_GIForig.gif


                                      А размеры Вы можете привести? Например, у дырки какие? И, например, у всего коннексона в поперечине?




                                      https://img-fotki.yandex.ru/get/373339/249950893.2/0_16b388_81cc2abc_GIForig.gif


                                      Кушелев: Давайте вместе посчитаем. Шаг альфа-спирали известен - 0,54 нм
                                      Считаем число витков, и умножаем на 0.54 нм
                                      Если я не ошибся, то внизу получилась масштабная линейка с шагом 0.54 нм. Считаем габаритный размер и размер отверстия. Габаритный размер 0.54*22=~12нм. Это грубая оценка. Если нужно, то можно вывести точный мастшаб в 3DS Max smile.gif Диаметр отверстия 0.54*(6...7)=~3...4 нм

                                      В этом ракурсе видно, что соседние коннексины должны входить в зацепление и двигаться до внешнего изгиба альфа-спирали соседнего коннексина. Четвертичную структуру удобнее собирать из 3D-распечаток субъединиц. В виртуальном пространстве сборку четвертичной структуры делать значительно сложнее. Хотя, если есть суперкомпьютер, специальные программы, шлем, перчатки, то может быть удобнее будет именно в виртуальном пространстве...



                                      Вот тут-то и проблемка...
                                      По РСА размер самой узкой части отверстия 1,4 нм, ошибка больше, чем в два раза. А это самая важная характеристика, связанная с пропускной способностью контакта. И точность РСА Вас тут уже не спасет.


                                      https://img-fotki.yandex.ru/get/900241/249950893.2/0_16b38b_d1fd2178_GIForig.gif


                                      Кушелев: В данном случае ошибка в два раза - вполне нормально. Я просто ошибся при сборке четвертичной структуры. Если зацепить коннексины, чтобы альфа-спираль одного коннексина двигалась внутри другого, то размер отверстия как раз совпадёт. Кроме того, точные размеры можно получить не на упрощённой модели, где один аминокислотный остаток показан 14-гранником, а на более точной модели, где один электрон показан одним кольцом.
                                      Так что не торопитесь с выводами. Сначала нужно правильно сложить субъединицы, а потом уже сравнивать
                                      В случае зацепления коннексинов размер отверстия коннексона получается 1.5-2 нм, но нужно учитывать, что в этой модели не показаны радикалы аминокислотных остатков. А радикалы могут уменьшить диаметр отверстия на 0.5...1 нм. Так что имеет смысл построить менее упрощённую пикотехнологическую модель четвертичной структуры коннексона.




                                      Кстати, я не понял, что означает размер Entrance diameter 35A ? Это размер отверстия при максимальном увеличении диафрагмы-коннексона?





                                      Кушелев: Тогда получается, что отверстие не может уменьшиться до нуля, как я пытаюсь изобразить в анимации? Тогда понятно, почему альфа-спирали налезают друг на друга. Они просто не могут до такой степени сблизиться, чтобы отверстие уменьшилось до нуля.
                                      А с выводами Вы зря торопитесь. Модель ещё не доделана. Есть только пикотехнологическая модель третичной структуры, которая построена автоматически.






                                      И вообще, я бы сказал, что общий вид коннексона, полученного с помощью Вашей модели, совершенно не похож на реальный.







                                      Кушелев: Все так считают?




                                      https://img-fotki.yandex.ru/get/373339/249950893.2/0_16b38c_ae23f333_orig.png


                                      В случае зацепления коннексинов размер отверстия коннексона получается 1.5-2 нм, но нужно учитывать, что в этой модели не показаны радикалы аминокислотных остатков. А радикалы могут уменьшить диаметр отверстия на 0.5...1 нм. Так что имеет смысл построить менее упрощённую пикотехнологическую модель четвертичной структуры коннексона.

                                      Программа Пикотех не делает четвертичную структуру. Я же Вам объяснил, что четвертичную структуру приходится собирать вручную. При этом делать это в виртуальном пространстве 3DS Max без виртуальных перчаток, стереошлема и специальной программы очень неудобно. Поэтому с первого раза угадать четвертичную структуру коннексона не удалось. Да и со второго раза тоже, т.к. альфа-спирали налезают друг на друга. Похоже, что субъединицы должны быть несколько повёрнуты по другим осям.
                                      Кстати, я не понял, что означает размер Entrance diameter 35A ? Это размер отверстия при максимальном увеличении диафрагмы-коннексона?
                                      Тогда получается, что отверстие не может уменьшиться до нуля, как я пытаюсь изобразить в анимации? Тогда понятно, почему альфа-спирали налезают друг на друга. Они просто не могут до такой степени сблизиться, чтобы отверстие уменьшилось до нуля.
                                      А с выводами Вы зря торопитесь. Модель ещё не доделана. Есть только пикотехнологическая модель третичной структуры, которая построена автоматически.







                                      Электроны вообще не бывают в виде колец! Они ни в виде ничего, они "размазаны" по некоторой области, причем трехмерной. В инертных газах это будут не кольца, а примерно сферы с некоторой, не определяемой точно толщиной, если же атом связан с какими-то другими атомом, то там уже это какие-то фигуры сложной формы.
                                      Приведите статью, в которой говорится, что есть ЭКСПЕРИМЕНТАЛЬНЫЕ данные, противоречащие данной конфигурации.






                                      Кушелев: Почему, собственно? Десятки исследователей пришли к выводу, что лептоны, в частности электроны имеют форму тора. Не знали? 
                                      Вот здесь подробнее можно узнать: http://nanoworld88.narod.ru/data/104.htm

                                      Кольцегранные модели атомов: https://nano-world-articles.nethouse.ru/page/1040802




                                      Повороты (изломы) спиралей на пролине



                                      Joint Pro and Proline tuning



                                      Вокруг какой оси гнётся пролин










                                      Как работает транспозиционный угол

                                      http://img-fotki.yandex.ru/get/6202/126580004.4a/0_b84ed_b613e191_orig.gif



                                      Пробный заказ для Института белка делается путем распечатки на 3D принтере жестких участков для последующей сборки пластмассовой модели с учетом изгиба на остатках пролина (Pro) и метионина (Met). 

                                      В исследуемом белке - 15 жестких участков, разделенных пролинами и 12 метионинов.


                                      Один изгиб на 377-ом Pro показан на этой анимации:










                                      Татьяна Рясина пишет:
                                      А  а если есть  аминокислотный остстаток Pro, он гнёт молекулу, это сустав.  И возникает 3D структура из 2D.


                                      Кушелев: Не просто гнёт. Белки и без Pro могут иметь "гнутую форму" и изломы. Например, альфа-спираль может "ломаться" на композиционных кодах бета-спирали или пи-спирали. И наоборот, пи-спираль может "ломаться" на композиционных кодах альфа-310-бета-спиралей.

                                      Когда же в структуре белка присутствует Pro, то в этом месте белок может гнуться в процессе функционирования, аналогично открыванию и закрыванию дверцы шкафа, сгибанию и разгибанию руки в суставе.


                                      Можно сделать версию программы Пикотех, которая будет показывать эту динамику:



                                      https://img-fotki.yandex.ru/get/872977/249950893.3/0_16b455_5a71bacc_GIForig.gif







                                      Аминокислотный остаток Pro


                                      https://img-fotki.yandex.ru/get/479612/249950893.2/0_16b38d_206c44f6_orig.png

                                      https://img-fotki.yandex.ru/get/874316/249950893.2/0_16b38e_e0918d28_GIForig.gif


                                      Некорректное изображение Pro выделено сиреневым цветом. Это помогло мне заметить, что спираль соединена с остальной частью белка как раз через пролин! Понятно, что спираль может поворачиваться на пролине и прижаться к остальной части белка.


                                      Согнув структуру белка на Pro62 мы можем пододвинуть His63 ещё ближе к His46 и His48. His120 тоже пододвинется к ним, если согнуть структуру белка на Pro66 и Pro74.
                                      Таким образом все 4 гистидина окажутся рядом без изменения композиционных углов!
                                      А вероятность такого совпадения будет 1/(3^17*3^57*3^2)=1/3^76=10^-36
                                      Один шанс из 1 000 000 000 000 000 000 000 000 000 000 000 000


                                      К сожалению, пока гибкость белка на пролинах ещё не реализована в программе Пикотех, поэтому такие белки можно доделывать пока только вручную. Но эта работа ничтожна по сравнению с основной, которую выполняет компьютер по табличной функции.


                                      В программе "Молекулярный конструктор" согнуть белок на пролинах должно быть проще, чем в программе 3DS Max. Попробуем?


                                      Кстати, обнаружился ещё один активный центр, состоящий из трёх аминокислотных остатков, к которым может приближаться и His63. Они выделены красным цветом.








                                      http://img-fotki.yandex.ru/get/4515/126580004.43/0_b3c81_4947634f_orig.png










                                      http://img-fotki.yandex.ru/get/5604/126580004.43/0_b3d1b_ccb360e6_L.jpg
                                      Оригинал: http://img-fotki.yandex.ru/get/5604/126 … 6_orig.jpg






                                      http://img-fotki.yandex.ru/get/4404/126580004.43/0_b3d2e_69145c39_L.jpg
                                      Оригинал: http://img-fotki.yandex.ru/get/4404/126 … 9_orig.jpg









                                      Атом, принадлежащий пролину (Pro22), помечен зелёным цветом. Именно в этом месте нужно согнуть модель белка


                                      Оригинал: http://img-fotki.yandex.ru/get/4515/126 … 1_orig.gif









                                      Оригинал: http://img-fotki.yandex.ru/get/5604/126 … c_orig.png













                                        http://img-fotki.yandex.ru/get/5604/126580004.43/0_b3e85_9a667df0_L.jpg
                                        Оригинал: http://img-fotki.yandex.ru/get/5604/126 … 0_orig.jpg








                                        НА ЗАМЕТКУ


                                        Программа PyMOL позволяет подписать аминокислотные остатки прямо на модели.


                                        http://img-fotki.yandex.ru/get/5506/126580004.43/0_b3c57_d261dc3b_S.gif
                                        Оригинал: http://img-fotki.yandex.ru/get/5506/126 … b_orig.gif





                                        http://img-fotki.yandex.ru/get/5506/126580004.43/0_b3c59_fd34d2cd_S.gif
                                        Оригинал: http://img-fotki.yandex.ru/get/5506/126 … d_orig.gif





                                        http://img-fotki.yandex.ru/get/5505/126580004.43/0_b3c5a_f678a0bd_S.gif
                                        Оригинал: http://img-fotki.yandex.ru/get/5505/126 … d_orig.gif





                                        http://img-fotki.yandex.ru/get/5009/126580004.43/0_b3c5c_3ef6decc_S.gif
                                        Оригинал: http://img-fotki.yandex.ru/get/5009/126 … c_orig.gif





                                        http://img-fotki.yandex.ru/get/4514/126580004.43/0_b3c5e_79e143b4_S.gif
                                        Оригинал: http://img-fotki.yandex.ru/get/4514/126 … 4_orig.gif





                                        http://img-fotki.yandex.ru/get/5604/126580004.43/0_b3c60_9c5c7bb4_S.gif
                                        Оригинал: http://img-fotki.yandex.ru/get/5604/126 … 4_orig.gif






                                        http://img-fotki.yandex.ru/get/58191/126580004.43/0_b3c61_eddb357b_S.gif
                                        Оригинал: http://img-fotki.yandex.ru/get/58191/12 … b_orig.gif






                                        3DS Max, PyMOL и PhotoShop позволяют подписать название аминокислотных остатков на пикотехнологической (кольцегранной) модели белка.






                                        Особенности построения моделей 3D Пикотех на основе структур 2D пикотех






                                        Геометрический алгоритм построения структур 3D Пикотех



                                        Геометрический алгоритм построения структур 3D Пикотех уже реализован.

                                        Пикотехнология 3D надежно работает на прямых участках фундаментальных спиралей:
                                        альфа-, 310-, бета-, пи-.   


                                        Геометрический алгоритм прекрасно работает для широкого класса структрур. В частности, для циклов окситоцина, которые замыкаются через десятки аминокислотных остатков через дисульфидные мостики:

                                        https://img-fotki.yandex.ru/get/874801/249950893.1/0_16b0ac_702642c5_GIForig.gif

                                        В общей сложности построены модели 6 замкнутых через дисульфидные мостики участков.
                                        1. Cys 95 - Cys 113 в человеческом лизоциме.
                                        2. Cys 96 - Cys 117 в альтернативном человеческом лизоциме.
                                        3. Cys 78 - Cys 82  в альтернативном человеческом лизоциме.
                                        4.  Cys 94 - Cys 98  в лизоциме куриного яйца
                                        5.  Met 1 - Cys 13  в мышином лизоциме
                                        6.  Met 1 - Cys 24  в лизоциме куриного яйца


                                        Кушелев:  В процессе исследования циклов разных лизоцимов, которые замыкаются через дисульфидные мостики, мне удалось обнаружить, что эти самые дисульфидные мостики возникают не только между цистеинами, но и между цистеином и метионином! Это научное открытие тоже прошло незамеченным, а зря...





                                        Можно констатировать факт корректности 3D модели, если, например, замкнулся дисульфидный мостик, как в случае фрагментов лизоцимов. Ведь вероятность случайного замыкания исчезающе мала (тридцатимиллиардная доля для фрагмента из 22 аминокислотных остатков). Во всех других случаях требуется проверка другими способами.


                                        Структуры белков сверх длинных спиралей легко проверить либо рентгеноструктурным анализом, либо химическими методами, которые позволяют определять структурную схему молекулы. Например, в 310-спирали водородная связь образуется между N-ой и (N+3)-ей пептидными группами. В альфа-спирали N -> (N+4), а в пи-спирали N -> (N+5).


                                        Учитывая, что РСА не может надёжно определить даже вторичную структуру белка, есть предложение проверять его по принципу "от простого к сложному", т.е. начиная с простых прямых фундаментальных 310-, альфа-, пи-спиралей. И такие белки удалось найти с помощью программы Пикотех 2D.


                                        Модель тройной спирали, вероятно, возникла по той причине, что первым была исследована программная 335-спираль коллагена-1, которая очень похожа на тройную спираль. Вот её модель:


                                        https://img-fotki.yandex.ru/get/373339/249950893.1/0_16b2fb_dde6856_GIForig.gif

                                        https://img-fotki.yandex.ru/get/373339/249950893.1/0_16b2fc_2f18fdf9_GIForig.gif




                                        Алгоритм с учётом физико-химических взаимодействий и свойств сустава Pro



                                        Что касается учёта физико-химических взаимодействий, то они общеизвестны. Виктория Соколик даже пытается пользоваться стандартными программами оптимизации моделей белковых структур. Но стандартные программы не учитывают геометрию и упругие свойства электронов, поэтому они непригодны для оптимизации пикотехнологических моделей. Нужно создавать программы нового поколения.


                                        Правильная 3D модель уже на уровне упрощённого геометрического алгоритма получается для тех участков белка, в которых нет аминокислотных остатков Pro и Met. Дело в том, что Met пока не смоделирован даже на геометрическом уровне, а Rpo - "сустав", т.е. гибкий иминокислотный остаток. Величина угла может меняться от разных факторов, которые могут быть учтены лишь при физико-химическом моделировании. В каждой аминокислоте есть не только композиционный, но и транспозиционный угол, который тоже может слегка меняться в зависимости от физико-химических взаимодействий. Наконец, некоторые белки после сборки разрезаются на части и переделываются, поэтому их структура не соответствует той, что получается в результате сборки по коду. Гарантией правильной 3D модели являются, например, дисульфидные мостики, как в случае моделей фрагментов окситоцинов.


                                        В отличие от аминокислотных остатков, Pro - это иминокислотный остаток, структура которого гнется не только в плоскости пептидной группы (транспозиционный угол), но и в другой плоскости (пролиновый угол). Увидеть это можно, например, на пластмассовой модели Pro. Эта модель является одной из ключевых в будущих версиях пикотехнологии 3D, поэтому является Ноу-Хау Лаборатории Наномир.




                                        Обращение к специалистам в области рентгено-структурного анализа, биоинформатики, биоматематики, медицинской биофизики и биохимии, других профильных и смежных областей

                                        *

                                        *

                                        Уважаемые коллеги!


                                        СОЗДАНИЕ РАСШИРЕННОЙ ВЕРСИИ ПИКОТЕХНОЛОГИИ


                                        Только 3% белков поддаются кристаллизации, т.е. могут быть исследованы методом РСА (рентгено-структурного анализа). Метод РСА трудоёмок, затратен по времени и стоимости.
                                        Метод Пикотех, основанный на открытии Композиционного генетического кода, бытро выдаёт точные, детальные и масштабируемые пространственные изображения белковых молекул.

                                        Силами нескольких программистов создан  Online service PROTEIN PICOTECHNOLOGY

                                        Стуктуры 2D Пикотех выполняются в автоматическом режиме. 
                                        Структуры 3D Пикотех в зависимости от состава молекул выполняются либо в автоматическом (по геометрическому шаблону) либо в ручном режиме (с учётом физико-химических взаимодействий, а также свойств сустава Pro, являющихся ноу-хау Лаборатории Наномир). 
                                        Фактически запрограммирована табличная функция "код-структура". Пространственная структура белка на уровне геометрического алгоритма тоже получается в первом приближении.

                                        Создвание программного обеспечения для построения  структур 3D Пикотех - более сложная задача, требующая участия коллектива программистов.

                                        Учитывая, что экономический эффект от создания полноценной системы "Пикотехнология 3D" трудно переоценить, хочу предложить Вам рассмотреть возможность решения этой грандиозной проблемы. 


                                        ЭКСПЕРИМЕНТАЛЬНОЕ ОПРЕДЕЛЕНИЕ СТРУКТУР ПРОГРАММЫНЫХ СПИРАЛЕЙ МЕТОДОМ РСА


                                        В лаборатории Наномир создана новая технология определения структуры белковых молекул, которая работает примерной в миллиард раз быстрее РСА. Наша задача в кратчайшие сроки проверить новую технологию, т.к. от её внедрения человечество может получить фантастический эффект. Просим сообщить о возмоности экспериментально выяснить структуры белков, приведённых ниже, методом рентгено-структурного анализа.


                                        Предлагаем проверить Пикотехнолгию белков на простых структурах типа поливалина:

                                        ETC64880: https://www.ncbi.nlm.nih.gov/nuccore/564568708

                                        OXS06857: https://www.ncbi.nlm.nih.gov/nuccore/1226034760

                                        KOF67455: https://www.ncbi.nlm.nih.gov/nuccore/918287724

                                        OUM69688: https://www.ncbi.nlm.nih.gov/nuccore/1198313040

                                        PIS11988: https://www.ncbi.nlm.nih.gov/nuccore/1277217132

                                        KOF75295: https://www.ncbi.nlm.nih.gov/nuccore/918302080

                                        OLP77457: https://www.ncbi.nlm.nih.gov/nuccore/1129165616

                                        KYM86846: https://www.ncbi.nlm.nih.gov/nuccore/1009361734?&fmt_mask=65536

                                        OTF86159: https://www.ncbi.nlm.nih.gov/nuccore/CM007906.1?report=fasta&sat=37&satkey=307832265&itemID=1362

                                        KKF17324: https://www.ncbi.nlm.nih.gov/nuccore/808866584?&fmt_mask=65536

                                        XP_002382247: https://www.ncbi.nlm.nih.gov/nuccore/238502026

                                        OLP98873: https://www.ncbi.nlm.nih.gov/nuccore/1129194414

                                        CDW76368: https://www.ncbi.nlm.nih.gov/nuccore/678335661

                                        AHB99005: https://www.ncbi.nlm.nih.gov/nuccore/564747871?&fmt_mask=65536

                                        OAQ27448: https://www.ncbi.nlm.nih.gov/nuccore/1032646064

                                        OUM69730: https://www.ncbi.nlm.nih.gov/nuccore/1198313040

                                        OGL53990: https://www.ncbi.nlm.nih.gov/nuccore/1084158629

                                        EIE92391: https://www.ncbi.nlm.nih.gov/nuccore/76151980

                                        XP_001590524: https://www.ncbi.nlm.nih.gov/nuccore/156049114

                                        OTG33229: https://www.ncbi.nlm.nih.gov/nuccore/CM007891.1?from=7600734&to=7601591&sat=37&sat_key=307832447

                                        OLQ06943: https://www.ncbi.nlm.nih.gov/nuccore/1129204435

                                        XP_001895277: https://www.ncbi.nlm.nih.gov/nuccore/170580473

                                        XP_001584576: https://www.ncbi.nlm.nih.gov/nuccore/156030497

                                        KOF84884: https://www.ncbi.nlm.nih.gov/nuccore/918315370



                                        С уважением,
                                        Александр Кушелев,
                                        Руководитель Лаборатории Наномир.
                                        +7 (903) 2003424
                                        kushelev20120@yandex.ru